L F95

General

End Date: 

Monday, June 10, 2013 (All day)

Experiment Batch ID: 

L

Start Date: 

Wednesday, April 17, 2013 - 14:29

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult
Adult

Number of Individuals (Start): 

29

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

UN17_g1274

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F95

Fragment concentration: 

600.00ng/ul

Fragment length: 

457bp

Sense sequence: 

ataaacgaaagtgcagcattggcatccctaatgattgttgtcacgttagaagaaggacaacaaagattcgattgcagcttgtgtcacagtcgttataaacatcattcttccctatttcgacattttaaatccgcccatcacaaagaatatgaagaaagagtagctttgagggtaaaattaaaggctgaaagggatgctgcgatatcccggggggaaccttatttacgtagacgtaatagtaagcggggcttacgaagtgttaaaaagaacaaggagaatactacctcagaatctgttgcgaaggaagcagaatctcctacaaaatcaacaagtaagacatcgacagttaatgttaaacacgagtttaaatctccaaaatcaccagccaagagtcagaaaaaaaacatcattcatataaaaattcaacccaaagttgaggaacctcacatttcgtctt

Fragment Producer: 

licelab

Primer Group: 

b1477
Phenotype

Phenotype CV: 

Number of Individuals (End): 

18

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

A group in experiment L. Exp has  been terminated, no obvious phenotype