E F51 (Ferr_LH)

General

End Date: 

Monday, November 26, 2012 (All day)

Experiment Description: 

<p>Ferr:_LH</p>

Experiment Batch ID: 

E

Start Date: 

Monday, October 15, 2012 (All day)

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

39

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

ferr_LH

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

51

Fragment Batch ID: 

F51B1

Fragment concentration: 

600.00ng/ul

Fragment length: 

676bp

Sense sequence: 

ctatttattgacaggctcaacgccgtgctttaagatgatcaaacaattattgcttttgtcaattttagttgcaagctgtgtgggaggacccgactcttgtggtgctcacactgatgtacaatgtgggaatcctggaacaaaatgggaatcagggatttgtaactcagtgtttggaggattcaaaggaaatactaggaacctctcggttcttatcaacagacatttgaatgacagtttcaaatatttggtcatggcaagttatttcgattctgcagaggtaaatcgaatgggatttaacaaatatattcaaggatactctgataagctatgggataatggaaaagacattctcaagtatgttttaagccgtggaggatctgcagatcccaatttgaaggttactgcaatgcaaatgccaaattatcagggagaagttttatctatgagcgcctctcttgacatgatgaaacaattaatggaggatatgcgattggtgtacaagcatgcggctaacaagcatgtctctaatactcaacctgagcgtgaaagctacgatcctcctctacttcactacttggaagagagcttttttgaggactatactgaaagaatcagggatctagcagggaaattaaatatccttggaaaaattgcccggaatgacaagaccaaatac

Fragment Producer: 

Christiane Trösse

Primer Group: 

Ferr_LH_f_b634
Validation

Efficacy of Knock Down: 

F>78.00%
Phenotype

Phenotype CV: 

Phenotype: 

Most lice didn’t have egg strings at termination (but had first and second which had fallen off and were found in the filter). No reproduction.

Number of Individuals (End): 

23

Gallery Image: 

Image file: 

Upload

Image Quality: 

3.5
Average: 3.5 (1 vote)

8a: 5 of 7 lice have no or very short egg strings. 3 of 7 lice have very little gut content.

8b: 3 of 5 lice have no or very short egg strings. 3 of 5 lice have very little gut content.

8c: 8 of 11 lice have no or very short egg strings. 4 of 11 lice have very little gut content.