no eggstrings

Mucin-like spermatophore wall protein 2 (AJ F270)

Phenotype CV: 

General

Experiment Batch ID: 

AJ

Experiment Contact: 

Start Date: 

21 March, 2017 - 09:08

End Date: 

25 April, 2017 - 09:08

Experiment Description: 

injection into young adut males, checking reproduction & spermatophore attachment of females
Sample

Organism: 

Sex: 

male

Number of Individuals (Start): 

30

Developmental Stage CV: 

Adult
Target description

Primary target ID: 

Gene or target symbol: 

MLSWP2
Fragment description

Fragment length: 

497bp

Fragment concentration: 

600ng/ul

Sense sequence: 

CCAGGCTTTTCACACGCTTT

Antisense sequence: 

GCTCTTGGCCGAGCATAAAA

Fragment Batch ID: 

F270

Fragment Label ID: 

F270
Validation

Efficacy of Knock Down: 

F>80%
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

male specific gene; checking spermatophore attachment to female

Mucin-like spermatophore wall protein 1 (AJ F269)

Phenotype CV: 

General

Experiment Batch ID: 

AJ

Experiment Contact: 

Start Date: 

21 March, 2017 - 09:08

End Date: 

25 April, 2017 - 09:08

Experiment Description: 

injection into young adult males, checking reproduction & spermatophore attachment of females
Sample

Organism: 

Sex: 

male

Number of Individuals (Start): 

30

Developmental Stage CV: 

Adult
Target description

Primary target ID: 

Gene or target symbol: 

MLSWP1
Fragment description

Fragment length: 

527bp

Fragment concentration: 

600ng/ul

Sense sequence: 

TTACGTTGGCAATCGTCGTC

Antisense sequence: 

GAAATCAAGTGCGGCTCCA

Fragment Batch ID: 

F269

Fragment Label ID: 

F269
Validation

Efficacy of Knock Down: 

F>95%
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

male specific gene; checking for spermatophore attachment to the female

C F4 (CopB2)

Phenotype CV: 

General

Experiment Batch ID: 

C

Experiment Contact: 

Start Date: 

14 August, 2012 - 09:00

End Date: 

24 September, 2012 - 09:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

LsCopB2
Fragment description

Fragment length: 

566bp

Fragment concentration: 

600ng/ul

Sense sequence: 

atcgtgtcaagtccacagacctgcacccagtggagccttggatgttggcctcgctctacaacgggaacgtgcacatttggaactacgagtctcagcagttggtcaagtccctggaggtgtgcgacttgccggtgcgagccgccaagtttgtgagccgtaagaattgggtggtgacgggttctgacgacatgaagctgaatgtgttcaactacaacaccctggagcgtgtgtcttgcctggaggcgcactctgactatctgcggtccctggccgtccacccgagtgagcccctggtcctctcctcctcggacgacatgctcattaagctctggaactgggacaaggcctgggcctgtgaacaggtcttcgagggacacacgcactacataatgcaagtggtcatcaaccccaaggacaacaacacttttgcctccgcctctttggaccgcaccatcaaggtctggcacttgggcgcatcttgccccaacttcactctggagggacatgacaagggcgtcaactgtctggactactaccacgccggggacaagccctacctcatctcg

Fragment Label ID: 

F4

Primer Group: 

b671

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>82%
Phenotype

Number of Individuals (End): 

0
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of LsCopB2 in preadult female lice. Early termination after 15 days (Rack 4a and 4b - no survivors in 4c at normal termination date). High mortality, empty gut, no egg strings, underdeveloped genital segment and abdomen.

A F4 (CopB2)

Phenotype CV: 

General

Experiment Batch ID: 

A

Experiment Contact: 

Start Date: 

23 January, 2012 - 09:00

End Date: 

24 February, 2012 - 09:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

LsCopB2
Fragment description

Fragment length: 

566bp

Fragment concentration: 

600ng/ul

Sense sequence: 

atcgtgtcaagtccacagacctgcacccagtggagccttggatgttggcctcgctctacaacgggaacgtgcacatttggaactacgagtctcagcagttggtcaagtccctggaggtgtgcgacttgccggtgcgagccgccaagtttgtgagccgtaagaattgggtggtgacgggttctgacgacatgaagctgaatgtgttcaactacaacaccctggagcgtgtgtcttgcctggaggcgcactctgactatctgcggtccctggccgtccacccgagtgagcccctggtcctctcctcctcggacgacatgctcattaagctctggaactgggacaaggcctgggcctgtgaacaggtcttcgagggacacacgcactacataatgcaagtggtcatcaaccccaaggacaacaacacttttgcctccgcctctttggaccgcaccatcaaggtctggcacttgggcgcatcttgccccaacttcactctggagggacatgacaagggcgtcaactgtctggactactaccacgccggggacaagccctacctcatctcg

Fragment Label ID: 

F4

Primer Group: 

b671

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>65%
Phenotype

Number of Individuals (End): 

5
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of LsCopB2 in preadult female lice. High mortality, empty gut, no egg strings, underdeveloped genital segment and abdomen.

D F39

Phenotype CV: 

General

Experiment Batch ID: 

D

Experiment Contact: 

Start Date: 

24 August, 2012 - 10:39
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

EcR

Target type: 

consensus_mRNA
Fragment description

Fragment length: 

820bp

Fragment concentration: 

600ng/ul

Fragment ID: 

Fragment Label ID: 

F39

Primer Group: 

b1025 LsEcR Frag2 F
Validation

Efficacy of Knock Down: 

F>0%
Phenotype

Number of Individuals (End): 

16

Phenotype: 

No eggstring production
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

No production of eggstrings Knockdown was not significant after 40 days

E F51 (Ferr_LH)

Phenotype CV: 

General

Experiment Batch ID: 

E

Experiment Contact: 

Start Date: 

15 October, 2012 (All day)

End Date: 

26 November, 2012 (All day)

Experiment Description: 

<p>Ferr:_LH</p>
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

ferr_LH
Fragment description

Fragment length: 

676bp

Fragment concentration: 

600ng/ul

Sense sequence: 

<p>ctatttattgacaggctcaacgccgtgctttaagatgatcaaacaattattgcttttgtcaattttagttgcaagctgtgtgggaggacccgactcttgtggtgctcacactgatgtacaatgtgggaatcctggaacaaaatgggaatcagggatttgtaactcagtgtttggaggattcaaaggaaatactaggaacctctcggttcttatcaacagacatttgaatgacagtttcaaatatttggtcatggcaagttatttcgattctgcagaggtaaatcgaatgggatttaacaaatatattcaaggatactctgataagctatgggataatggaaaagacattctcaagtatgttttaagccgtggaggatctgcagatcccaatttgaaggttactgcaatgcaaatgccaaattatcagggagaagttttatctatgagcgcctctcttgacatgatgaaacaattaatggaggatatgcgattggtgtacaagcatgcggctaacaagcatgtctctaatactcaacctgagcgtgaaagctacgatcctcctctacttcactacttggaagagagcttttttgaggactatactgaaagaatcagggatctagcagggaaattaaatatccttggaaaaattgcccggaatgacaagaccaaatac</p>

Fragment Batch ID: 

F51B1

Fragment Label ID: 

51

Primer Group: 

Ferr_LH_f_b634

Fragment Producer: 

Christiane Trösse

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>78%
Phenotype

Number of Individuals (End): 

23

Phenotype: 

Most lice didn’t have egg strings at termination (but had first and second which had fallen off and were found in the filter). No reproduction.
Upload

Image file: 

Gallery Image: 

Image Quality: 

3.5
Average: 3.5 (1 vote)

8a: 5 of 7 lice have no or very short egg strings. 3 of 7 lice have very little gut content.

8b: 3 of 5 lice have no or very short egg strings. 3 of 5 lice have very little gut content.

8c: 8 of 11 lice have no or very short egg strings. 4 of 11 lice have very little gut content.

RNA-B EcR knockdown

Phenotype CV: 

General

Experiment Batch ID: 

RNAB

Start Date: 

19 March, 2012 - 09:06

End Date: 

20 April, 2012 (All day)

Experiment Description: 

<p>Knockdown of EcR. CPY185 used as control</p>
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult
Fragment description

Fragment length: 

667bp

Fragment concentration: 

600ng/ul

Fragment Label ID: 

18

Primer Group: 

Validation

Efficacy of Knock Down: 

F>20%
Phenotype

Number of Individuals (End): 

14
Upload

Image file: 

Image Quality: 

0
No votes yet

Sampled lice had no eggstrings except one whioch most likely have not been injected properly.

 

 

H F60

Phenotype CV: 

General

Experiment Batch ID: 

H

Experiment Contact: 

Start Date: 

15 January, 2013 - 13:17

End Date: 

25 February, 2013 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Adult female
Target description
Fragment description

Fragment length: 

542bp

Fragment concentration: 

600ng/ul

Sense sequence: 

ccacgggcccaggaactgttcatttgacaggttatttgattcccgacactgacgacatgattgacgacctcgattcagagtctgaatgtttnnnnnnnnnnnnnnnnnnagctcctgtccttgttaatggaaagggcaagaacaccaaacgtaagcctgataatagcttaattgatactcctaataaaaaagctaaaaaagagttggaacttgctagagctaaaaaagttcagtccgatcttaacttgaagaagaagagtcaaaagaaagtcgagtcttcggatgatgataacgatatggaagcagatgatgatacgtcggatgatggaatattagatttcactgagaattacgctgaagaagaggactctgtcgatgaatctgatgacgaatacgaggatgattcttcagtagaagaaggcgattcctctccaacaaagaaaattctcgagaaaatagccaataaaaaggagtcttctctcactactcccaagaacaataagaaaaaggataatgcctccactcctaaaggcgctactccc

Fragment Label ID: 

F60

Primer Group: 

FK506_f_b1313
Validation

Efficacy of Knock Down: 

F>14%
Phenotype

Number of Individuals (End): 

13

Phenotype: 

no reproduction
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of 3343

E F42

Phenotype CV: 

General

Experiment Batch ID: 

E

Experiment Contact: 

Start Date: 

15 October, 2012 - 10:19

End Date: 

26 November, 2012 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

g13677_Rheb
Fragment description

Fragment length: 

460bp

Fragment concentration: 

600ng/ul

Sense sequence: 

atggggcctcccaagtctcgtaaaattgccttaatgggagctgtttccgtgggcaaatcttctctggccatccaatttgtacaaggacaatttgtcgattcctacgaaccaacaatcgaaaatacatttaccaaaacagttaaaattaatagacaagaatatgaaatttgtcttgttgatacagcaggccaaaatgaatactctatctttccattggaatattctgtaggaatagatggatatgttcttgtatactccattgattcacctaaaagcttagaagtttgtcaaatcatacaggaaaaattaatagaattcacaggaaacccaaatgttcccattgtcttggttggcaataaaaatgatttgtatatggaaagatatgtttcctttgaagaaggcaaaagaagagctgaagaaatgaaagcagtgtttcttgagacctctgccaaggaaaacc

Fragment Label ID: 

F42

Primer Group: 

Rheb_f_b1063

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>60%
Phenotype

Number of Individuals (End): 

25

Phenotype: 

Low reproduction and most are missing blood in the gut
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Downregulation of Rheb

E F34

Phenotype CV: 

General

Experiment Batch ID: 

E

Experiment Contact: 

Start Date: 

15 October, 2012 - 00:04

End Date: 

26 November, 2012 (All day)

Experiment Description: 

<p>24 females recovered (62%), 7 with normal looking eggstrings, that hatch. Animals with eggstrings have blood in the gut, animals w/o eggstrings have little or no blood. Theis group of animals looked almost normal and was reproducing until 3 days before termination (last check). Seem to have been caught just when the system broke down. Reproducing animals had normally developed cops (morph and numbers)</p>
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

g7499_LsRaptor
Fragment description

Fragment length: 

451bp

Fragment concentration: 

600ng/ul

Sense sequence: 

tcaagattcctcctcaactgccgctactccttggagactccttgaacgaatgaaaactgtgagtgttgctcttgtggtatgcctcaatgtcggggtggatcctccggatgtgacgaaaacctccccttgtgcttgtattgaggcatggattgatccaactcttctcaatccaacaagagcacttaatctcattggatctgctcttctaagacaatatgaacgttggcaacccagggctaggtatagacaatctttggacccaactgtggacgaagtccgacgcctagctatggctctacgtaaaaacgctagggatgaaagagttctttttcattataatggtcatggggtcccgaaaccaacggcaaacggagagatttgggtttttaatcggaattacactcagtatattcccctgagtctctacgatcttcaaacatggatgggctcc

Fragment Label ID: 

F34

Primer Group: 

Raptor_f_b918

Fragment Producer: 

Heidi
Validation

Efficacy of Knock Down: 

F>50%
Phenotype

Number of Individuals (End): 

24
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of 3242

Pages

Subscribe to RSS - no eggstrings