no eggstrings

AV F404

Phenotype CV: 

General

Experiment Batch ID: 

AV

Experiment Contact: 

Start Date: 

14 March, 2019 - 08:35

End Date: 

24 April, 2019 - 08:23

Experiment Description: 

injection into pradult females
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult1
Adult
Target description
Fragment description

Fragment length: 

400bp

Fragment concentration: 

600ng/ul

Sense sequence: 

TGTTGGCCCTATGAGTCCATCT TTTTTGTGACTTTGATGCCTTGA

Antisense sequence: 

TGATCCTTGGAAGAAAAGAGGATG TTCATCATTTCCAGCATTGAGTTT

Fragment Label ID: 

F404

Fragment Mixture Formula: 

50% of both, in total 600 ng/ul

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>50%
Phenotype

Number of Individuals (End): 

15
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of a testis-specific ion-pump in pre-adult1 males, checking reproduction in adults. Many males were lost, and no kncokdown observed.

AS F384

Phenotype CV: 

General

Experiment Batch ID: 

AS

Experiment Contact: 

Start Date: 

21 August, 2018 - 09:08

End Date: 

24 September, 2018 - 09:08

Experiment Description: 

Knockdown of one cement-gland gene.
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description
Fragment description

Fragment concentration: 

600ng/ul

Fragment Batch ID: 

F384

Fragment Label ID: 

F384

Fragment Mixture Formula: 

F381+F382+F383 in same ratio
Validation

Efficacy of Knock Down: 

F>99%
Phenotype

Number of Individuals (End): 

21
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

knockdown lead to missing egg strings

AL F339

Phenotype CV: 

General

Experiment Batch ID: 

RNA_AL

Experiment Contact: 

Start Date: 

28 August, 2017 - 10:00

End Date: 

6 October, 2017 - 00:00

Experiment Description: 

Knockdown of the nuclear receptor FTZF1
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Adult
Target description
Fragment description

Fragment length: 

499bp

Sense sequence: 

gtgatagggcacggaaactgcaagtcttgcgt Caaagacaagtgatacacggtggagtttccatgggcccaagtagcatgaataatacgaca Accacaacgagtagtagtgcatcctacggcggcggtgcctccggtggaatgaactccacg Agtagccctccatccatgaacaataataataataacaattccccctcaatctacggctca Cccatcactcatattaaacaagagatacaaataccacaagtcacatctatgacgtcttca Ccagatacttcaccctctcccgttcatttacccggaatgatttctaatcctggaggcaat Ccaatgggtggagatactccgggctccaatcccatcattgcccaacagactgatcctgcc Ggaggtattcaatggcagatcaatgctgctggaaagcatcaggatatccaaagtaatcaa Ggaactgggaaaatgccagccatcattcgagaattccttgcctccct

Fragment ID: 

Fragment Batch ID: 

F339

Fragment Label ID: 

F339

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>45%
Phenotype

Number of Individuals (End): 

7

Phenotype: 

No eggstrings
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of FTZF1 targetting both isoforms, alpha and beta. Only alpha is downregulated, few survivors. Sectioning reveals disorganization of eggs in genital segment, resulting in no eggstrings, same as probe F338 (other entry).

AL F338

Phenotype CV: 

General

Experiment Batch ID: 

RNA_AL

Experiment Contact: 

Start Date: 

28 August, 2017 - 10:00

End Date: 

6 October, 2017 - 10:00

Experiment Description: 

Knockdown of the nuclear receptor Fushi tarazu factor 1 (FTZF1)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Adult
Target description
Fragment description

Fragment length: 

467bp

Sense sequence: 

cgccttcatcatcgacaacaacatccatactaacctcatctacaaataaaaaacctcgttccctcaaaatcgtcgaatgtctcgactct tcctcgacgacacacaccacagcctctccatcgtcgccatcaacctcttcatggaatctc Attcttccttcgcatccttccgtagaatcaccttcatcgtcttcgagtccttctcatcaa Ggagggggagataaagagatatcctctgtggttatagcagcctctacgaccacgacagca Actaaaagatcatttagtcaacatatcatggaagaagaggaagaggacgaagacgaagaa Gaggctggaggacacttatcttggaaccctgatgaagagcaggatcaatcagctgaggag Gatgcaggactaccaacagcatccagtaacaacaactccgctggatccacatccggagacttcggtcctggagttgtg

Fragment ID: 

Fragment Batch ID: 

F338

Fragment Label ID: 

F338

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>45%
Phenotype

Number of Individuals (End): 

12

Phenotype: 

No eggstrings
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of the nuclear FTZ-F1 in pre-adult 2. Knockdown resulted in strange genital segments. Sectioning revealed disorganization of eggs in genital segment.

AL Hormone receptor 3 (HR3)

Phenotype CV: 

General

Experiment Batch ID: 

RNA_AL

Experiment Contact: 

Start Date: 

28 August, 2017 - 10:00

End Date: 

6 October, 2017 - 10:00

Experiment Description: 

Knockdown of the ortholog of the nuclear receptor HR3. Injection of pre-adult 2 females
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

EMLSAG00000000733

Target type: 

mRNA
Fragment description

Fragment length: 

441bp

Sense sequence: 

gccta Gcaccattcgagcaagaaatctcattgcaaaacaaacaaacaaaaaggattcatagaata Aatagaaaaaggaccctacaaggcaaaaaaaacagcaactattttttacaaattgtttcg Tactcgtcgatgcaaaatcagaaatattatacgaatttgtcctcaatggattggatatca Ggctatcgtcttccatccaattcggatttaaagtgtgatgatgatcaccatggcggcggg Gcaggagtacagcatgcatctgttgtcggcggaccaacaggcggagcactaggatctggc Tcttccggtcccctcacaaacaacaccaattccaactcttcctcaccctccatgctaggc Atgtgggcagcagctgtggccaatacacctcttaaagtggaaacagctgatcatcatgga Aatggatctctggtgg

Fragment Batch ID: 

F341

Fragment Label ID: 

F341

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>90%
Phenotype

Number of Individuals (End): 

17

Phenotype: 

No eggstrings. Disorganization of eggs in genital segment
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of HR3 in pre-adult 2 females. Resulted in no eggstring production. Sections reveals disorganized eggs in genital segment. Ovaries look normal.

AQ F375 EMLSAG00000008959

Phenotype CV: 

General

Experiment Batch ID: 

RAQ

Experiment Contact: 

Start Date: 

16 April, 2018 - 09:00

End Date: 

23 May, 2018 - 09:00

Experiment Description: 

Knock-down of EMLSAG00000008959
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

EMLSAG00000008959
Fragment description

Fragment length: 

432bp

Fragment concentration: 

600ng/ul

Sense sequence: 

gcctccggttcggatgaagaagtagaagaggaagaaataactgaatatgatgccttgttaaaggtgtatggagctcaaacatatgttgatgaagctgaagaggaagagatatgcgaaggagaaatggaggaggaagaaaacgatatggatgaggaagatgtatcattgaatggagtagatgggatagatgaagaagatttattgtcgaatgaagaagaaaatgaaactatcgatctcgaaagtggagaagatgaaaatgaaactatcgatctcgaaagtggagaagaggaaaatgaaactatcgatctcgaaagtggagaagaagaagaagagattgtggatactgatatcggaagkgrtatattagatgaaaatgaggatgaatttccagagatggatgacgaaaawgacacttgtggcccctctgatcct

Fragment Label ID: 

F375

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

5

Phenotype: 

no eggstreng
Upload

Image file: 

Image Quality: 

0
No votes yet

Knock-down of EMLSAT00000003179. No visible phenotype

AP F366 EMLSAT00000001458

Phenotype CV: 

General

Experiment Batch ID: 

AP

Experiment Contact: 

Start Date: 

6 March, 2018 - 09:00

End Date: 

10 April, 2018 - 09:00

Experiment Description: 

EMLSAG1458 knock-down
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

EMLSAG00000001458
Fragment description

Fragment length: 

412bp

Fragment concentration: 

600ng/ul

Sense sequence: 

>F366 caagctgttattgattggcgattctggtgtaggcaaatcgtgcttactattaagatttgctgatgatacttacacagaaagttacataagtacaattggtgttgactttaagattagaacaattgaactcgacggaaagactatcaagttgcaaatctgggatactgcaggccaagaaagattcagaactatcacatccagttactatcgtggtgcccacggaatcatcgttgtatatgacgttacggaccaggattcttttaataaccttaagcaatggcttcaagaaattgatagatacgcatgtgaaaatgtaaacaagcttcttgtgggaaacaaatgtgatctgacaacaaagaaggttgtagattatacaactgcaaaagaatacgctgatcagttaaatatgccg

Fragment Label ID: 

F366

Primer Group: 

likb2502_T7_b2515

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>77%
Phenotype

Number of Individuals (End): 

13

Phenotype: 

no eggstreng
Upload

Image Quality: 

0
No votes yet

Testing the fragment for Mvp1 knock-down.

Mucin-like spermatophore wall protein 2 (AJ F270)

Phenotype CV: 

General

Experiment Batch ID: 

AJ

Experiment Contact: 

Start Date: 

21 March, 2017 - 09:08

End Date: 

25 April, 2017 - 09:08

Experiment Description: 

injection into young adut males, checking reproduction & spermatophore attachment of females
Sample

Organism: 

Sex: 

male

Number of Individuals (Start): 

30

Developmental Stage CV: 

Adult
Target description

Primary target ID: 

Gene or target symbol: 

MLSWP2
Fragment description

Fragment length: 

497bp

Fragment concentration: 

600ng/ul

Sense sequence: 

CCAGGCTTTTCACACGCTTT

Antisense sequence: 

GCTCTTGGCCGAGCATAAAA

Fragment Batch ID: 

F270

Fragment Label ID: 

F270
Validation

Efficacy of Knock Down: 

F>80%
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

Control fragment used for all samples

Mucin-like spermatophore wall protein 1 (AJ F269)

Phenotype CV: 

General

Experiment Batch ID: 

AJ

Experiment Contact: 

Start Date: 

21 March, 2017 - 09:08

End Date: 

25 April, 2017 - 09:08

Experiment Description: 

injection into young adult males, checking reproduction & spermatophore attachment of females
Sample

Organism: 

Sex: 

male

Number of Individuals (Start): 

30

Developmental Stage CV: 

Adult
Target description

Primary target ID: 

Gene or target symbol: 

MLSWP1
Fragment description

Fragment length: 

527bp

Fragment concentration: 

600ng/ul

Sense sequence: 

TTACGTTGGCAATCGTCGTC

Antisense sequence: 

GAAATCAAGTGCGGCTCCA

Fragment Batch ID: 

F269

Fragment Label ID: 

F269
Validation

Efficacy of Knock Down: 

F>95%
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

Control fragment used for all samples

AC F0S

Phenotype CV: 

General

Experiment Batch ID: 

AC

Experiment Contact: 

Start Date: 

14 December, 2015 - 09:53

End Date: 

25 January, 2016 - 09:53
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

31

Developmental Stage CV: 

Adult
Target description

Primary target ID: 

Gene or target symbol: 

CPY short version
Fragment description

Fragment length: 

320bp

Fragment concentration: 

600ng/ul

Sense sequence: 

cgttctgctcctcggagctgtcttcgctgaggaggacaagatcgtcggagggtatgagtgtacgaggcactcccaggcccaccaggtgtctctgaactctggataccacttctgtggaggctccctggtcagcaaggactgggtggtgtctgctgctcactgctacaagtcccgtattgaggtgcgtctgggcgagcaccacatcagggtcaacgagggaaccgagcagttcatctcctcctccagcgtcatccgtcaccccaactacagctcctacaacatcgacaacgacatcatgctgatcaagctgagcaagcccg

Fragment Label ID: 

F0

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

21
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Testing new and  shorter fragment of CPY

New fragment is 320 bp and called F0S

Pages

Subscribe to RSS - no eggstrings