no eggstrings

AV F404

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

14 March, 2019 - 08:35

End Date: 

24 April, 2019 - 08:23

Experiment Description: 

injection into pradult females




Number of Individuals (Start): 


Developmental Stage CV: 

Target description
Fragment description

Fragment length: 


Fragment concentration: 


Sense sequence: 


Antisense sequence: 


Fragment Label ID: 


Fragment Mixture Formula: 

50% of both, in total 600 ng/ul

Fragment Producer: 


Fragment Producer Contact: 


Efficacy of Knock Down: 


Number of Individuals (End): 


Image file: 

Gallery Image: 

Image Quality: 

No votes yet

Knockdown of FCGPO1 & FCGPO2 leads to missing/abnormal egg strings.


AS F384

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

21 August, 2018 - 09:08

End Date: 

24 September, 2018 - 09:08

Experiment Description: 

Knockdown of one cement-gland gene.




Number of Individuals (Start): 


Developmental Stage CV: 

Target description
Fragment description

Fragment concentration: 


Fragment Batch ID: 


Fragment Label ID: 


Fragment Mixture Formula: 

F381+F382+F383 in same ratio

Efficacy of Knock Down: 


Number of Individuals (End): 


Image file: 

Gallery Image: 

Image Quality: 

No votes yet

Knockdown of EMLSAT00000002328, EMLSAT00000011195, EMLSAT00000010070 leads to missing egg strings.


AL F339

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

28 August, 2017 - 10:00

End Date: 

6 October, 2017 (All day)

Experiment Description: 

Knockdown of the nuclear receptor FTZF1




Number of Individuals (Start): 


Developmental Stage CV: 

Target description
Fragment description

Fragment length: 


Sense sequence: 

gtgatagggcacggaaactgcaagtcttgcgt Caaagacaagtgatacacggtggagtttccatgggcccaagtagcatgaataatacgaca Accacaacgagtagtagtgcatcctacggcggcggtgcctccggtggaatgaactccacg Agtagccctccatccatgaacaataataataataacaattccccctcaatctacggctca Cccatcactcatattaaacaagagatacaaataccacaagtcacatctatgacgtcttca Ccagatacttcaccctctcccgttcatttacccggaatgatttctaatcctggaggcaat Ccaatgggtggagatactccgggctccaatcccatcattgcccaacagactgatcctgcc Ggaggtattcaatggcagatcaatgctgctggaaagcatcaggatatccaaagtaatcaa Ggaactgggaaaatgccagccatcattcgagaattccttgcctccct

Fragment ID: 

Fragment Batch ID: 


Fragment Label ID: 


Fragment Producer: 


Fragment Producer Contact: 


Efficacy of Knock Down: 


Number of Individuals (End): 



No eggstrings

Image file: 

Gallery Image: 

Image Quality: 

No votes yet

Knockdown of FTZF1 targetting both isoforms, alpha and beta. Only alpha is downregulated, few survivors. Sectioning reveals disorganization of eggs in genital segment, resulting in no eggstrings, same as probe F338 (other entry).

AL F338

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

28 August, 2017 - 10:00

End Date: 

6 October, 2017 - 10:00

Experiment Description: 

Knockdown of the nuclear receptor Fushi tarazu factor 1 (FTZF1)




Number of Individuals (Start): 


Developmental Stage CV: 

Target description
Fragment description

Fragment length: 


Sense sequence: 

cgccttcatcatcgacaacaacatccatactaacctcatctacaaataaaaaacctcgttccctcaaaatcgtcgaatgtctcgactct tcctcgacgacacacaccacagcctctccatcgtcgccatcaacctcttcatggaatctc Attcttccttcgcatccttccgtagaatcaccttcatcgtcttcgagtccttctcatcaa Ggagggggagataaagagatatcctctgtggttatagcagcctctacgaccacgacagca Actaaaagatcatttagtcaacatatcatggaagaagaggaagaggacgaagacgaagaa Gaggctggaggacacttatcttggaaccctgatgaagagcaggatcaatcagctgaggag Gatgcaggactaccaacagcatccagtaacaacaactccgctggatccacatccggagacttcggtcctggagttgtg

Fragment ID: 

Fragment Batch ID: 


Fragment Label ID: 


Fragment Producer: 


Fragment Producer Contact: 


Efficacy of Knock Down: 


Number of Individuals (End): 



No eggstrings

Image file: 

Gallery Image: 

Image Quality: 

No votes yet

Knockdown of the nuclear FTZ-F1 in pre-adult 2. Knockdown resulted in strange genital segments. Sectioning revealed disorganization of eggs in genital segment.

AL Hormone receptor 3 (HR3)

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

28 August, 2017 - 10:00

End Date: 

6 October, 2017 - 10:00

Experiment Description: 

Knockdown of the ortholog of the nuclear receptor HR3. Injection of pre-adult 2 females




Number of Individuals (Start): 


Developmental Stage CV: 

Target description

Primary target ID: 

Gene or target symbol: 


Target type: 

Fragment description

Fragment length: 


Sense sequence: 

gccta Gcaccattcgagcaagaaatctcattgcaaaacaaacaaacaaaaaggattcatagaata Aatagaaaaaggaccctacaaggcaaaaaaaacagcaactattttttacaaattgtttcg Tactcgtcgatgcaaaatcagaaatattatacgaatttgtcctcaatggattggatatca Ggctatcgtcttccatccaattcggatttaaagtgtgatgatgatcaccatggcggcggg Gcaggagtacagcatgcatctgttgtcggcggaccaacaggcggagcactaggatctggc Tcttccggtcccctcacaaacaacaccaattccaactcttcctcaccctccatgctaggc Atgtgggcagcagctgtggccaatacacctcttaaagtggaaacagctgatcatcatgga Aatggatctctggtgg

Fragment Batch ID: 


Fragment Label ID: 


Fragment Producer: 


Fragment Producer Contact: 


Efficacy of Knock Down: 


Number of Individuals (End): 



No eggstrings. Disorganization of eggs in genital segment

Image file: 

Gallery Image: 

Image Quality: 

No votes yet

Knockdown of HR3 in pre-adult 2 females. Resulted in no eggstring production. Sections reveals disorganized eggs in genital segment. Ovaries look normal.

AQ F375 EMLSAG00000008959

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

16 April, 2018 - 09:00

End Date: 

23 May, 2018 - 09:00

Experiment Description: 

Knock-down of EMLSAG00000008959




Number of Individuals (Start): 


Developmental Stage CV: 

Target description

Primary target ID: 

Gene or target symbol: 

Fragment description

Fragment length: 


Fragment concentration: 


Sense sequence: 


Fragment Label ID: 


Fragment Producer: 


Fragment Producer Contact: 


Number of Individuals (End): 



no eggstreng

Image file: 

Image Quality: 

No votes yet

Knock-down of EMLSAT00000008959

AP F366 EMLSAT00000001458

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

6 March, 2018 - 09:00

End Date: 

10 April, 2018 - 09:00

Experiment Description: 

EMLSAG1458 knock-down




Number of Individuals (Start): 


Developmental Stage CV: 

Target description

Primary target ID: 

Gene or target symbol: 

Fragment description

Fragment length: 


Fragment concentration: 


Sense sequence: 

>F366 caagctgttattgattggcgattctggtgtaggcaaatcgtgcttactattaagatttgctgatgatacttacacagaaagttacataagtacaattggtgttgactttaagattagaacaattgaactcgacggaaagactatcaagttgcaaatctgggatactgcaggccaagaaagattcagaactatcacatccagttactatcgtggtgcccacggaatcatcgttgtatatgacgttacggaccaggattcttttaataaccttaagcaatggcttcaagaaattgatagatacgcatgtgaaaatgtaaacaagcttcttgtgggaaacaaatgtgatctgacaacaaagaaggttgtagattatacaactgcaaaagaatacgctgatcagttaaatatgccg

Fragment Label ID: 


Primer Group: 


Fragment Producer: 


Fragment Producer Contact: 


Efficacy of Knock Down: 


Number of Individuals (End): 



no eggstreng

Image Quality: 

No votes yet

Knock-down of EMLSAT00000001458.

Mucin-like spermatophore wall protein 2 (AJ F270)

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

21 March, 2017 - 09:08

End Date: 

25 April, 2017 - 09:08

Experiment Description: 

injection into young adut males, checking reproduction & spermatophore attachment of females




Number of Individuals (Start): 


Developmental Stage CV: 

Target description

Primary target ID: 

Gene or target symbol: 

Fragment description

Fragment length: 


Fragment concentration: 


Sense sequence: 


Antisense sequence: 


Fragment Batch ID: 


Fragment Label ID: 


Efficacy of Knock Down: 


Gallery Image: 

Image Quality: 

No votes yet

male specific gene; checking spermatophore attachment to female

Mucin-like spermatophore wall protein 1 (AJ F269)

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

21 March, 2017 - 09:08

End Date: 

25 April, 2017 - 09:08

Experiment Description: 

injection into young adult males, checking reproduction & spermatophore attachment of females




Number of Individuals (Start): 


Developmental Stage CV: 

Target description

Primary target ID: 

Gene or target symbol: 

Fragment description

Fragment length: 


Fragment concentration: 


Sense sequence: 


Antisense sequence: 


Fragment Batch ID: 


Fragment Label ID: 


Efficacy of Knock Down: 


Gallery Image: 

Image Quality: 

No votes yet

male specific gene; checking for spermatophore attachment to the female


Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

14 December, 2015 - 09:53

End Date: 

25 January, 2016 - 09:53




Number of Individuals (Start): 


Developmental Stage CV: 

Target description

Primary target ID: 

Gene or target symbol: 

CPY short version
Fragment description

Fragment length: 


Fragment concentration: 


Sense sequence: 


Fragment Label ID: 


Fragment Producer Contact: 


Number of Individuals (End): 


Image file: 

Gallery Image: 

Image Quality: 

No votes yet

Testing new and  shorter fragment of CPY

New fragment is 320 bp and called F0S


Subscribe to RSS - no eggstrings