O F88

General

End Date: 

Wednesday, January 8, 2014 (All day)

Experiment Batch ID: 

O

Start Date: 

Monday, December 2, 2013 - 10:45

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

38

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F88

Fragment Batch ID: 

O

Fragment concentration: 

600.00ng/ul

Fragment length: 

403bp

Sense sequence: 

gacgaatgcgaaggctcctacgtatcctcatcagtcctcacagtagggcccatctatgaagacatagttgaaaataaaacacccgaagtcctctactacaactctccaatacaaccttcttctgagcaaactcctcccccacctttaccctcaggaccccgaggacgctcaaatatgaatattagtaatgcttctcctaatttaccaccagattccgctggcccctcctcgcattgtaccaccagttccagcgaagttagcatcgattccaattcctcacccatcaaacatgtcgttctcaacccaactagcggagcacatcatcacccccatcaccatcctagtagacccttttcaacccctcgcactccacctgctcgcacaggtggagtttattactaca

Fragment Producer: 

licelab

Primer Group: 

UN5_g339_f_b1394
Phenotype

Phenotype CV: 

Number of Individuals (End): 

10

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

No visible phenotype