U F52

General

End Date: 

Wednesday, January 14, 2015 - 00:00

Experiment Batch ID: 

U

Start Date: 

Wednesday, December 3, 2014 - 13:54

Experiment Contact: 

Sample

Developmental Stage CV: 

Adult
Adult

Number of Individuals (Start): 

30

Sex: 

male

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F52

Fragment concentration: 

600.00ng/ul

Fragment length: 

494bp

Sense sequence: 

cgagtgacacaacgccgcaagaagtccaaaccactacgactaaagcgatgtcttccacggagcaagaacctacaacgacgactctactttctgactccaaagaatcatctgagcccaaaaaagaactcacaaagaaaatgagcataaaaaaggaccaagaacatacaattgattcaataattccatgtactgatatagatgaggacgcttgtcaatcttttaaaccactttgtaaaatcgaaatcgaaataggatttcgtcgttgtcaaaaaacatgcggtttttgcaaggggaagagacttatttatgaggccaaaatttcaaacggtgttgaaggacttgtagaatttcaacaattttatccgagacagcctgtatatatggctggttgttttgaaaaatctggtataaaaaacacaattactccacacgcttttgttattcatgaaagaagtgaagaaccttcaatgaaggattccaaatgcccacatgca

Primer Group: 

g4675_f_b1230
Phenotype

Phenotype CV: 

Phenotype: 

Non-hatching eggstrings

Number of Individuals (End): 

10

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

This experiment was performed by injection of males only in the normal set-up, i.e. young adult males and placed on fish together with non-injected females. Only males were sampled at termination, but females were photographed and eggstrings put for hatching (photos named as the hatching well).

A total of 10 males and 24 females were recovered. Tank A had two female w/o eggstrings and 5 with non-hatching eggstrings (1 male left). Tank B had 8 females, 1 non-hatching eggstring and 7 normal (5 males left). Tank C had 9 females, one w/o, 3 non-hatching and 5 hatching (4 males).  All hatched larvae developed to copepodites

En han til snitting

Annotering : dual specificity mitogen-activated protein kinase kinase !  litt uttrykk i preadult hanner, ellers bare hanner