abnormal egg strings

U F52

Phenotype CV: 

General

Experiment Batch ID: 

U

Experiment Contact: 

Start Date: 

3 December, 2014 - 13:54

End Date: 

14 January, 2015 (All day)
Sample

Organism: 

Sex: 

male

Number of Individuals (Start): 

30

Developmental Stage CV: 

Adult
Adult
Target description
Fragment description

Fragment length: 

494bp

Fragment concentration: 

600ng/ul

Sense sequence: 

cgagtgacacaacgccgcaagaagtccaaaccactacgactaaagcgatgtcttccacggagcaagaacctacaacgacgactctactttctgactccaaagaatcatctgagcccaaaaaagaactcacaaagaaaatgagcataaaaaaggaccaagaacatacaattgattcaataattccatgtactgatatagatgaggacgcttgtcaatcttttaaaccactttgtaaaatcgaaatcgaaataggatttcgtcgttgtcaaaaaacatgcggtttttgcaaggggaagagacttatttatgaggccaaaatttcaaacggtgttgaaggacttgtagaatttcaacaattttatccgagacagcctgtatatatggctggttgttttgaaaaatctggtataaaaaacacaattactccacacgcttttgttattcatgaaagaagtgaagaaccttcaatgaaggattccaaatgcccacatgca

Fragment Label ID: 

F52

Primer Group: 

g4675_f_b1230

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

10

Phenotype: 

Non-hatching eggstrings
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

This experiment was performed by injection of males only in the normal set-up, i.e. young adult males and placed on fish together with non-injected females. Only males were sampled at termination, but females were photographed and eggstrings put for hatching (photos named as the hatching well).

T F166

Phenotype CV: 

General

Experiment Batch ID: 

T

Experiment Contact: 

Start Date: 

30 October, 2014 - 13:20

End Date: 

9 December, 2014 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

UN50_10071
Fragment description

Fragment length: 

457bp

Fragment concentration: 

600ng/ul

Sense sequence: 

cgaatccgcagatgaaggagtctatgacttctgggtgtctccacgtgtgggctcttatgctaaggtaatggttgctcctggatacgtttctacattcgaacaattcttgaaggagcaayccattgcctctactcttttgattgaggatgtggaaattactaatcaaagattttccatcattgaaaatgctttaagaaaaatcaaaacttcatccagatcaattgactttgaaaactactacagttcagacgatcttraagccgataatggctttgtcgaagttgaaacctatggaaaatcctacgaaggtagagacttaaaggtcatcaagattatgaaggctggacctaatgctcccaatatcttcattgaggctggaattcatgcacaagatcctgaaaatgctcgttaccttgaccaattcaatttccacatcatgccttccgttaaccccgat

Fragment Label ID: 

F166

Primer Group: 

likb2496_T7_b2546

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>96%
Phenotype

Number of Individuals (End): 

19

Phenotype: 

Abnormal
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

 

Short and malformed eggstrings, no mortality

R F161

Phenotype CV: 

General

Experiment Batch ID: 

RNAi R

Experiment Contact: 

Start Date: 

21 August, 2014 - 10:10

End Date: 

1 October, 2014 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

37

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

UN38_580
Fragment description

Fragment length: 

472bp

Fragment concentration: 

600ng/ul

Fragment Label ID: 

F

Primer Group: 

b2527

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>99%
Phenotype

Number of Individuals (End): 

20

Phenotype: 

Abnormal eggstrings in some individuals
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

The experiment was performed to check the phenotype of the gene. Abnormal eggstringproduction was observed at termination. Normal looking copepods developed from the eggstrings. Normal Activity. Sample RFR2 was sent for sectioning, abnormal

Subscribe to RSS - abnormal egg strings