Submitted by Aina-Cathrine Ø... on 21 February, 2017 - 10:25 GeneralEnd Date: Monday, February 13, 2017 - 10:27Experiment Description: Gene knock-Down in nauplia, infestation of fish when copepodids and sampled 6 and 12 dpi (12 degrees). Experiment Batch ID: ExpAStart Date: Wednesday, February 1, 2017 - 10:26Experiment Contact: Aina-Cathrine ØvergårdSussie Dalvin SampleDevelopmental Stage CV: Nauplius Ichalamus II/padINumber of Individuals (Start): 550Sex: bothOrganism: Lepeophtheirus salmonis Target descriptionPrimary target ID: EMLSAT00000000504, EMLSAT00000000504-696351 (mRNA) Lepeophtheirus salmonis Fragment descriptionFragment Label ID: F230Fragment concentration: 600.00ng/ulFragment length: 192bpSense sequence: gaacaacgcaatctggacaagtgaaaaagagatgtttcggacgtagaccaagaccaagaccatcagcaaatcttagtgttaaggacttgatggatttaataaaaatgattatggaacttgcaaaaaagaaaggtgctgagaaaagaaatattgtttcaagtccaactatgactcatgttaaagtactctccg ValidationEfficacy of Knock Down: F>98.50% PhenotypePhenotype CV: no visible phenotypePhenotype: No phenotypeNumber of Individuals (End): 240 UploadImage Quality: 0 No votes yet .. Log in to post comments