2839/5061/10390

General

End Date: 

Wednesday, February 7, 2018 - 10:14

Experiment Description: 

Experiment Batch ID: 

n

Start Date: 

Wednesday, January 31, 2018 - 10:03

Experiment Contact: 

Sample

Developmental Stage CV: 

Nauplius

Sex: 

unknown

Organism: 

Target description
Fragment description

Antisense sequence: 

TGTGCCCATACAGCCTTGAC AGCTGAGATGGCGATGGAAT TGAGTGCCAACTCATGTGACC

Fragment Label ID: 

F

Fragment Batch ID: 

Sense sequence: 

TTTGGCCATTTCTGATCTCATT AGATGGCATCCCTGAGGAAC GCATTTATGCAACGCTATTGG

Fragment Mixture Formula: 

Fragment Producer: 

Phenotype

Phenotype: 

No visible phenotype
Upload

Image Quality: 

0
No votes yet

Knockdown of 6502.
Variations are too big to see a downregulation