LsHSCARB on free living stages

General

End Date: 

Tuesday, August 2, 2016 - 10:00

Experiment Description: 

Knock-down evaluation of primers

Experiment Batch ID: 

F289

Start Date: 

Tuesday, July 26, 2016 - 09:55

Experiment Contact: 

Publication: 

Sample

Developmental Stage CV: 

Nauplius I
Copepodid

Number of Individuals (Start): 

300

Sex: 

unknown

Organism: 

Target description
Fragment description

Fragment Label ID: 

F289

Fragment concentration: 

10.00ng/ul

Fragment length: 

731bp

Sense sequence: 

AGCGGATAAACTCGATGGCTTGCCAAAAACAGTAAAAGATATTTGTTTTGAAATTATAAATAATGGTAATGAAGCTCTAGGTATTAAGGCCGAAGATTTATTTATTACTGAAGAAGTTGACAAAATCCTATACACGGGCTTCGACTCTAAGTCTGCTGCTATCTTTGATAAATTGGATACATTTCTTATGCTCTTGTTAGAAGTCATACAAGAATCCTTGGAGTTGGATATACCAATTAAAGCAAAAGACTTTGAAAACATAATCAAAATCATTAGTCCTGCACAGCTTTCAGAAGGGACTTTTGCTTTTTTCAAAGGTAAAAATGCAACCAAATTGCAGAATTACTATACCATTGAAAACGGACGGTTCGATAAAGAAAGTTTTATGAATATTGTTGAGTTCAATGGTAAGAATAAATTACCTGAGGCTTKGTGGCCTAATGTAGCCACAAGTATAACGGGKCAACTTTCAAGTGAGGGTGGCTCATGCCATAGAATCTATGGAACGGATGGGACTCAATTTCCACCGTTTTTATTTAACAAGAAAAAATTTCCTTTGTGGATGTTTGTGGGAGAGCTTTGTAGAACAATATATGTGGAGTTTGAGTCCGAAGTGGAAGTGGAAGGAGGGATCACAGCCTATCGTTATGGAGTAGGGAAGAGAGTTTTCTCAATGAGTAACCCTGAAAACTTTTGTTATTGTCAAGAATTTTTCTCATGCGCCAAGCAAA
Validation

Efficacy of Knock Down: 

F>99.00%
Phenotype

Phenotype CV: 

Phenotype: 

none

Number of Individuals (End): 

250
Upload

Image Quality: 

0
No votes yet

Test in freeliving stages.