LsCHS1

General

End Date: 

Monday, February 26, 2018 - 10:11

Experiment Batch ID: 

PAM1

Start Date: 

Tuesday, February 20, 2018 - 09:00

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdultI males

Number of Individuals (Start): 

60

Sex: 

males

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F

Fragment concentration: 

498.00ng/ul

Fragment length: 

174bp

Sense sequence: 

TGGTGTGAGGCGTTAGAACCATTGGAAAATAGTGCCGACATGCATCGGGATGCTCTGTACGGGCGTACGGGAGCATCAGACCTATACTCTAAAATGTCTCGCTCTGGGATGCAGGACTTGAGAGGAGGCGATGATCTTGATGAATTTACGGATGATGAAGCCACTCCACTCACG
Validation

Efficacy of Knock Down: 

F>80.00%
Phenotype

Phenotype CV: 

Phenotype: 

In preAdultII: Could not complete molting or had thin exoskeleton (could not swim).
Upload

Image Quality: 

0
No votes yet

Primers name: ChS1_f_dsRNA_b4611, ChS1_r_dsRNA_b4612, the primers were designed before the transcripts were analyzed by sequencing and RACE.