Molting

beta FTZ-F1

Phenotype CV: 

General

Experiment Batch ID: 

Experiment bFTZ-F1

Experiment Contact: 

Start Date: 

17 January, 2018 - 13:00

End Date: 

24 January, 2018 - 13:00

Experiment Description: 

Sampled larvae at middle/old nauplius 2 to measure downregulation before visible phenotype.
Sample

Organism: 

Sex: 

both

Developmental Stage CV: 

Nauplius
Copepodid
Target description
Fragment description

Fragment length: 

468bp

Fragment concentration: 

10ng/ul

Sense sequence: 

ttgaggacaacaacgacgactcta Ctatactcattagctatacattgttgtgtggatttcgaaaagagacgcggacgataagga Gcagggaatttgtgatttcgaaaaaaaaatagtaaaaatgtgccatggtggtttgagatg Accaaatacatttataagggcaagttacgtgaaaaaggcccttgaatgttacccacggaa Cctcttattagtattccgtattctaaccaacgtggacgtttccatcaaccccatattcaa Gagctgcctctcgcagccccgggttctaatcatagatcatcatccctgatccttataaaa Aaagagccgaatatgagcacaagtggaagcttgagtagcggtggtagtcctcccatggtt Ggaggaacactcctcccaaccatggatatgccgatcggaaactcatttgcttccttggaa Gacctgagcagtgtagtccatcca

Fragment ID: 

Fragment Batch ID: 

beta FTZ-F1

Fragment Label ID: 

beta FTZ-F1

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>50%
Phenotype

Number of Individuals (End): 

0

Phenotype: 

Developmental arrest
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Soaking of larvae with dsRNA specific for the transcript variant beta for the gene FTZ-F1. Resulted in developmental arrest.

LsCHS1

Phenotype CV: 

General

Experiment Batch ID: 

PAM1

Experiment Contact: 

Start Date: 

20 February, 2018 - 09:00

End Date: 

26 February, 2018 - 10:11
Sample

Organism: 

Sex: 

males

Number of Individuals (Start): 

60

Developmental Stage CV: 

PreAdultI males
Target description
Fragment description

Fragment length: 

174bp

Fragment concentration: 

498ng/ul

Sense sequence: 

TGGTGTGAGGCGTTAGAACCATTGGAAAATAGTGCCGACATGCATCGGGATGCTCTGTACGGGCGTACGGGAGCATCAGACCTATACTCTAAAATGTCTCGCTCTGGGATGCAGGACTTGAGAGGAGGCGATGATCTTGATGAATTTACGGATGATGAAGCCACTCCACTCACG

Fragment Label ID: 

F

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>80%
Phenotype

Phenotype: 

In preAdultII: Could not complete molting or had thin exoskeleton (could not swim).
Upload

Image Quality: 

0
No votes yet

Primers name:
ChS1_f_dsRNA_b4611
ChS1_r_dsRNA_b4612

Subscribe to RSS - Molting