developmental defect

RNAi_AS 11369+12062

Phenotype CV: 

General

Experiment Batch ID: 

RNAi_AS

Experiment Contact: 

Start Date: 

21 August, 2017 - 13:24

End Date: 

24 September, 2018 (All day)
Sample

Organism: 

Sex: 

female

Developmental Stage CV: 

preadult II femal
Target description
Fragment description

Fragment Label ID: 

F389
Validation

Efficacy of Knock Down: 

F>90%
Upload

Image Quality: 

0
No votes yet

developmenta details, no egg-strings, no gut contant. All genes downregulated by around 90%

RNAi_AS 11366+11369+10832

Phenotype CV: 

General

Experiment Batch ID: 

RNAi_AS

Experiment Contact: 

Start Date: 

21 August, 2017 - 13:24

End Date: 

24 September, 2018 (All day)

Experiment Description: 

Sample

Organism: 

Sex: 

female

Developmental Stage CV: 

preadult II femal
Target description
Fragment description

Sense sequence: 

Antisense sequence: 

Fragment Batch ID: 

Fragment Label ID: 

F388

Fragment Mixture Formula: 

Fragment Producer: 

Validation

Efficacy of Knock Down: 

F>90%
Phenotype

Phenotype: 

Upload

Image Quality: 

0
No votes yet

developmenta details, no egg-strings, no gut contant. All genes downregulated by around 90%

RNAi_AS 11366+12062

Phenotype CV: 

General

Experiment Batch ID: 

RNAi_AS

Experiment Contact: 

Start Date: 

21 August, 2017 - 13:24

End Date: 

24 September, 2018 (All day)
Sample

Organism: 

Sex: 

female

Developmental Stage CV: 

preadult II femal
Target description
Fragment description

Fragment Label ID: 

F386
Validation

Efficacy of Knock Down: 

F>90%
Upload

Image Quality: 

0
No votes yet

delevlopmental defects, empty intestine, no egg strings. Both genes are down-regulated by around 90%

beta FTZ-F1

Phenotype CV: 

General

Experiment Batch ID: 

Experiment bFTZ-F1

Experiment Contact: 

Start Date: 

17 January, 2018 - 13:00

End Date: 

24 January, 2018 - 13:00

Experiment Description: 

Sampled larvae at middle/old nauplius 2 to measure downregulation before visible phenotype.
Sample

Organism: 

Sex: 

both

Developmental Stage CV: 

Nauplius
Copepodid
Target description
Fragment description

Fragment length: 

468bp

Fragment concentration: 

10ng/ul

Sense sequence: 

ttgaggacaacaacgacgactcta Ctatactcattagctatacattgttgtgtggatttcgaaaagagacgcggacgataagga Gcagggaatttgtgatttcgaaaaaaaaatagtaaaaatgtgccatggtggtttgagatg Accaaatacatttataagggcaagttacgtgaaaaaggcccttgaatgttacccacggaa Cctcttattagtattccgtattctaaccaacgtggacgtttccatcaaccccatattcaa Gagctgcctctcgcagccccgggttctaatcatagatcatcatccctgatccttataaaa Aaagagccgaatatgagcacaagtggaagcttgagtagcggtggtagtcctcccatggtt Ggaggaacactcctcccaaccatggatatgccgatcggaaactcatttgcttccttggaa Gacctgagcagtgtagtccatcca

Fragment ID: 

Fragment Batch ID: 

beta FTZ-F1

Fragment Label ID: 

beta FTZ-F1

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>50%
Phenotype

Number of Individuals (End): 

0

Phenotype: 

Developmental arrest
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Soaking of larvae with dsRNA specific for the transcript variant beta for the gene FTZ-F1. Resulted in developmental arrest.

Nauplii I 6889-2

Phenotype CV: 

General

Experiment Batch ID: 

N

Experiment Contact: 

Start Date: 

1 February, 2016 - 14:40

End Date: 

10 February, 2016 - 01:41

Experiment Description: 

Sample

Organism: 

Sex: 

unknown

Developmental Stage CV: 

Nauplius I
Target description

Primary target ID: 

Target type: 

Fragment description

Sense sequence: 

Antisense sequence: 

Fragment Batch ID: 

Fragment Label ID: 

F293

Fragment Mixture Formula: 

Fragment Producer: 

Validation

Efficacy of Knock Down: 

F>80%
Phenotype

Phenotype: 

Upload

Image Quality: 

0
No votes yet

no movement,

RNAi_AN 10832+11366+11369+12062

Phenotype CV: 

General

Experiment Batch ID: 

RNAi_AN

Experiment Contact: 

Start Date: 

1 November, 2017 - 13:24

End Date: 

3 January, 2018 (All day)
Sample

Organism: 

Sex: 

both

Developmental Stage CV: 

preadult I male
preadult I female
Target description
Fragment description

Fragment Label ID: 

F345
Validation

Efficacy of Knock Down: 

F>90%
Upload

Image Quality: 

0
No votes yet

delevlopmental defects, empty intestine, no egg strings

RNAi_AN 3895

Phenotype CV: 

General

Experiment Batch ID: 

RNAi_AN

Experiment Contact: 

Start Date: 

1 November, 2017 - 13:24

End Date: 

3 January, 2018 (All day)

Experiment Description: 

Sample

Organism: 

Sex: 

both

Developmental Stage CV: 

preadult I male
preadult I female
Target description

Primary target ID: 

Target type: 

Fragment description

Sense sequence: 

Antisense sequence: 

Fragment Batch ID: 

Fragment Label ID: 

F354

Fragment Mixture Formula: 

Primer Group: 

Fragment Producer: 

Validation

Efficacy of Knock Down: 

F>99%
Phenotype

Phenotype: 

Upload

Image Quality: 

0
No votes yet

delevlopmental defects, problem withe moulting

LsCHS1

Phenotype CV: 

General

Experiment Batch ID: 

PAM1

Experiment Contact: 

Start Date: 

20 February, 2018 - 09:00

End Date: 

26 February, 2018 - 10:11
Sample

Organism: 

Sex: 

males

Number of Individuals (Start): 

60

Developmental Stage CV: 

PreAdultI males
Target description
Fragment description

Fragment length: 

174bp

Fragment concentration: 

498ng/ul

Sense sequence: 

TGGTGTGAGGCGTTAGAACCATTGGAAAATAGTGCCGACATGCATCGGGATGCTCTGTACGGGCGTACGGGAGCATCAGACCTATACTCTAAAATGTCTCGCTCTGGGATGCAGGACTTGAGAGGAGGCGATGATCTTGATGAATTTACGGATGATGAAGCCACTCCACTCACG

Fragment Label ID: 

F

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>80%
Phenotype

Phenotype: 

In preAdultII: Could not complete molting or had thin exoskeleton (could not swim).
Upload

Image Quality: 

0
No votes yet

Primers name:
ChS1_f_dsRNA_b4611
ChS1_r_dsRNA_b4612

F149

Phenotype CV: 

General

Experiment Batch ID: 

F149

Experiment Contact: 

Start Date: 

1 April, 2014 - 14:02

End Date: 

8 April, 2014 (All day)
Sample

Organism: 

Sex: 

both

Number of Individuals (Start): 

200

Developmental Stage CV: 

Nauplius1
Copepodid
Target description
Fragment description

Fragment length: 

757bp

Fragment concentration: 

10ng/ul

Fragment Label ID: 

F149

Primer Group: 

b2373
Validation

Efficacy of Knock Down: 

F>80%
Phenotype

Number of Individuals (End): 

190

Phenotype: 

Development of gut affected
Upload

Image Quality: 

0
No votes yet

dd

Subscribe to RSS - developmental defect