AP F247 EMLSAG00000005706

General

End Date: 

Tuesday, April 10, 2018 - 09:00

Experiment Description: 

Knock-down of EMLSAG00000005706

Experiment Batch ID: 

RAP

Start Date: 

Tuesday, March 6, 2018 - 09:00

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

31

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F247

Fragment concentration: 

600.00ng/ul

Sense sequence: 

ATTTGAATGAACCTGCAGCAGCAACTCTTGGTGAGGATTTTCATATATCTTACATCTTTGGCTCATACCCTAAGCCAAAAATTGAAGACATAATATGGAGAATTAAGGGAACTGAGGATGTAAACATTGAGTTAAAAGCAAAAAACCCAAGGGATCCATCCGTATTTATGGATGGAAAATATATTTTGGATCCAATTATAAATGCTGGAGATCAAATGTATAGCATTGGTTTTACTATTTCAAACGTTACTGAAGAGGATTTTGCAAGAACTTACGATGTGAAAATTAGTAATCGTAAAAAACATTCCAACGATCTTATCCTTTCAACAGTTCACACTTTTGACATACAAACGTCAACTGCAGGTGGATCCAGTGACACTGGATCATCAAGTACTGTTACAGGGATCGTTATATCCATTGCGCTAATTCTTTTGCTCATTACTCTTGTCACGATCCTCGTAATGACTTATATGTACAAAAAGTGGTGTTTTGCTCCCAAAGATCCTCATTCCAAGCCAGGGTATGATGGAGACGTTGAACA

Fragment Producer: 

licelab
Phenotype

Phenotype CV: 

Phenotype: 

No visible phenotype

Image file: 

Upload

Image Quality: 

0
No votes yet

Knock-down of EMLSAT00000005706