EMLSAT00000001458 cop + infection

General

End Date: 

Friday, June 1, 2018 - 10:00

Experiment Description: 

downregulation of EMLSAT00000001458 in nauplia1 and infection of salmon with copepodids

Experiment Batch ID: 

network_moult nauplia + infection

Start Date: 

Wednesday, May 9, 2018 - 09:00

Experiment Contact: 

Sample

Developmental Stage CV: 

Nauplius1
Copepodid

Number of Individuals (Start): 

60

Sex: 

both

Organism: 

Target description

Gene or target symbol: 

RAB1A

Target type: 

mRNA

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F366

Fragment concentration: 

20.00ng/ul

Fragment length: 

412bp

Sense sequence: 

caagctgttattgattggcgattctggtgtaggcaaatcgtgcttactattaagatttgctgatgatacttacacagaaagttacataagtacaattggtgttgactttaagattagaacaattgaactcgacggaaagactatcaagttgcaaatctgggatactgcaggccaagaaagattcagaactatcacatccagttactatcgtggtgcccacggaatcatcgttgtatatgacgttacggaccaggattcttttaataaccttaagcaatggcttcaagaaattgatagatacgcatgtgaaaatgtaaacaagcttcttgtgggaaacaaatgtgatctgacaacaaagaaggttgtagattatacaactgcaaaagaatacgctgatcagttaaatatgccg

Fragment Producer: 

Licelab
Phenotype

Phenotype CV: 

Phenotype: 

no lice survived to the end of experiment, where control lice were mainly chalimus 2

Number of Individuals (End): 

0
Upload

Image Quality: 

0
No votes yet

downregulation of EMLSAT00000001458 in nauplia1 and infection of salmon with copepodids