AV F353

General

End Date: 

Wednesday, April 24, 2019 - 09:00

Experiment Description: 

Downregulation of variant 2_2

Experiment Batch ID: 

AV

Start Date: 

Thursday, March 14, 2019 - 09:00

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F353

Fragment concentration: 

600.00ng/ul

Fragment length: 

670bp

Sense sequence: 

tcaagcgacgaggaattattgctactcaaggaagaaaattcttacttaatgaagagtacgctgactgatgatggaaaagaactccttcccaaagatggtaaaggtagttttgtgggaggagacgctagagctcttctaaccactggtttggcttcagttcataccttattcgttcgggaacataatcgaatatcaaggaaacttgctcagatgaatccttcatacacaaacgaaactgtttttcaagaaactcggcgaatattgggagcaatgatgcaaaatattgtttatagtgaatttcttccgacgttattaggggaaaaaagcatgaatgagtctggcttaaacttaaaatacccctcgagttatcatgaagaaattaatccaactgtcgcctctgttttcgttgctgctgcatacagatttggccattccatgattcaaaggaatgtgaatcgattggctataaaaaaatatagctatagcagtaattattccttatttaaggacttttttaatacggcaaattacgaggataggaatgggctaggaatagaagaaattttatatgggttgacctatttcccagcacaatctgcagaccgttttgttgtaaaagaagtaactaattatttgttcaataatggaaagccgtatggagcagatcttg

Fragment Producer: 

licelab

Primer Group: 

likb2502_T7_b2515
Phenotype

Phenotype CV: 

Phenotype: 

normal

Number of Individuals (End): 

11

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Downregulation of 4874. F352 and F353 are different fragment from the same gene