Motility

The intensity of movement observed by observation.

Functional characterization of a heme Peroxidase (Nauplia) F159

Phenotype CV: 

General

Experiment Batch ID: 

Exp 1

Experiment Contact: 

Start Date: 

7 June, 2016 - 12:30

End Date: 

17 June, 2016 - 12:33
Sample

Organism: 

Sex: 

both

Number of Individuals (Start): 

400

Developmental Stage CV: 

Nauplius1
Copepodid
Target description
Fragment description

Fragment length: 

936bp

Fragment concentration: 

600ng/ul

Sense sequence: 

acttgcattacctatgaggcagtcaatgctgcatttaccactgccttagaaagagtaggacttccacctgtaaggggaaagttcactactgatgatgtgggtaatcttggaactgtgattcatgaaacgagtcgttaccttgccaaacagtatggcctatctaaagatgctatttctaatggactacctctcattgatactactaagaccatcattgaaggctactgtccaccctttttgatgactccaaagtgcacagtggagcgttacagaagtgttaacggaatgtgtaacaacgtagagcaccctcattggggagcggctatgaatggacatcacagattccttgcacctaattttgcagatggaatctctgctccaagggcctccaaaactggaaatcctcttccttctgctcgtattgtttcatctaatatgcacagagatgaaggattccacgatcatgctgtgactattcttctcgtagcctggggacagtttattgatcacgatatcactcttagtgctgaaacaaaggatcctcgtacagggaaaacacccaagtgttgtgaagagggacaaactgctgttcatcccaattgcttgccaatcgaaatcccatctcatgatacattcttctcaaaacacaagcaacgttgtatgaactttgttcgttctcaagccggtcttcgttacaattgcagactaggaccccgtgataccttcaatgaagtatcatccctcctagatgctggaaccgtgtactccaactctgatgagactcttgagagtttgagactctacaaggacggactccttaaaatgttgcccgtttttaatgaatttgaaatgaaggaactccttcctcttaaattggaatctcctgatgagggttgcattagaccttcagaagatgtgtattgtttcttggctgga

Fragment Label ID: 

F159

Fragment Producer: 

Aina-Cathrine Øvergård
Validation

Efficacy of Knock Down: 

F>89%
Phenotype

Number of Individuals (End): 

400

Phenotype: 

Decreased swimming activity
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

Heme peroxidases are the most abundant type of peroxidase catalyzing a H2O2-dependent oxidation of a wide variety of substrates. They are involved in numerous processes like the innate immune response, hormone and prostaglandin synthesis and crosslinking of proteins within extracellular matrixes (ECM) as well as molecules within the cuticle and chorion of arthropods and nematodes. In the present study, a Lepeophtheirus salmonis heme peroxidase (LsHPX) 1 was characterized.

Subscribe to RSS - Motility