Mucin-like spermatophore wall protein 1 (AJ F269)

General

End Date: 

Tuesday, April 25, 2017 - 09:08

Experiment Description: 

injection into young adult males, checking reproduction & spermatophore attachment of females

Experiment Batch ID: 

AJ

Start Date: 

Tuesday, March 21, 2017 - 09:08

Experiment Contact: 

Publication: 

Sample

Developmental Stage CV: 

Adult

Sex: 

male

Number of Individuals (Start): 

30

Organism: 

Target description

Gene or target symbol: 

MLSWP1

Primary target ID: 

Fragment description

Antisense sequence: 

GAAATCAAGTGCGGCTCCA

Fragment Label ID: 

F269

Fragment Batch ID: 

F269

Fragment concentration: 

600.00ng/ul

Fragment length: 

527bp

Sense sequence: 

TTACGTTGGCAATCGTCGTC
Validation

Efficacy of Knock Down: 

F>95.00%
Phenotype
Upload

Image Quality: 

0
No votes yet
AttachmentSize
Image icon spermatophore-attachment-7670.png3.34 MB

Control fragment used for all samples