Mucin-like spermatophore wall protein 2 (AJ F270) Submitted by Andreas Borchel on 26 March, 2018 - 10:39 Phenotype CV: female reproductionno eggstringsno spermatophoreGeneralExperiment Batch ID: AJExperiment Contact: Andreas BorchelStart Date: 21 March, 2017 - 09:08End Date: 25 April, 2017 - 09:08Experiment Description: injection into young adut males, checking reproduction & spermatophore attachment of females SampleOrganism: Lepeophtheirus salmonisSex: maleNumber of Individuals (Start): 30Developmental Stage CV: Adult Target descriptionPrimary target ID: EMLSAT00000000183, EMLSAT00000000183-696030 (mRNA) Lepeophtheirus salmonisGene or target symbol: MLSWP2 Fragment descriptionFragment length: 497bpFragment concentration: 600ng/ulSense sequence: CCAGGCTTTTCACACGCTTTAntisense sequence: GCTCTTGGCCGAGCATAAAAFragment Batch ID: F270Fragment Label ID: F270 ValidationEfficacy of Knock Down: F>80% UploadGallery Image: Image Quality: 0 No votes yet Control fragment used for all samples Read more about Mucin-like spermatophore wall protein 2 (AJ F270)Log in to post comments
Mucin-like spermatophore wall protein 1 (AJ F269) Submitted by Andreas Borchel on 26 March, 2018 - 10:34 Phenotype CV: female reproductionno eggstringsno spermatophoreGeneralExperiment Batch ID: AJExperiment Contact: Andreas BorchelStart Date: 21 March, 2017 - 09:08End Date: 25 April, 2017 - 09:08Experiment Description: injection into young adult males, checking reproduction & spermatophore attachment of females SampleOrganism: Lepeophtheirus salmonisSex: maleNumber of Individuals (Start): 30Developmental Stage CV: Adult Target descriptionPrimary target ID: EMLSAT00000007670, EMLSAT00000007670-703517 (mRNA) Lepeophtheirus salmonisGene or target symbol: MLSWP1 Fragment descriptionFragment length: 527bpFragment concentration: 600ng/ulSense sequence: TTACGTTGGCAATCGTCGTCAntisense sequence: GAAATCAAGTGCGGCTCCAFragment Batch ID: F269Fragment Label ID: F269 ValidationEfficacy of Knock Down: F>95% UploadGallery Image: Image Quality: 0 No votes yet Control fragment used for all samples Read more about Mucin-like spermatophore wall protein 1 (AJ F269)Log in to post comments
AA F222 Submitted by Anna Komisarczuk on 20 October, 2015 - 14:33 Phenotype CV: female reproductionno spermatophoreGeneralExperiment Batch ID: AAExperiment Contact: Anna KomisarczukStart Date: 8 September, 2015 - 14:29End Date: 15 October, 2015 - 00:00 SampleOrganism: Lepeophtheirus salmonisSex: bothNumber of Individuals (Start): 120Developmental Stage CV: PreAdult1 femalePreAdult2 male Target descriptionPrimary target ID: EMLSAG00000012262, EMLSAG00000012262-695028 (gene) Lepeophtheirus salmonisEMLSAG00000004547, EMLSAG00000004547-687313 (gene) Lepeophtheirus salmonisEMLSAG00000009341, EMLSAG00000009341-692107 (gene) Lepeophtheirus salmonisEMLSAG00000012296, EMLSAG00000012296-695062 (gene) Lepeophtheirus salmonis Fragment descriptionFragment Label ID: F222Primer Group: UploadImage Quality: 0 No votes yet No spermatophores on females. Specific? Mix of dsRNA against 4 genes. Read more about AA F222Log in to post comments