no spermatophore

Mucin-like spermatophore wall protein 2 (AJ F270)

Phenotype CV: 

General

Experiment Batch ID: 

AJ

Experiment Contact: 

Start Date: 

21 March, 2017 - 09:08

End Date: 

25 April, 2017 - 09:08

Experiment Description: 

injection into young adut males, checking reproduction & spermatophore attachment of females
Sample

Organism: 

Sex: 

male

Number of Individuals (Start): 

30

Developmental Stage CV: 

Adult
Target description

Primary target ID: 

Gene or target symbol: 

MLSWP2
Fragment description

Fragment length: 

497bp

Fragment concentration: 

600ng/ul

Sense sequence: 

CCAGGCTTTTCACACGCTTT

Antisense sequence: 

GCTCTTGGCCGAGCATAAAA

Fragment Batch ID: 

F270

Fragment Label ID: 

F270
Validation

Efficacy of Knock Down: 

F>80%
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

male specific gene; checking spermatophore attachment to female

Mucin-like spermatophore wall protein 1 (AJ F269)

Phenotype CV: 

General

Experiment Batch ID: 

AJ

Experiment Contact: 

Start Date: 

21 March, 2017 - 09:08

End Date: 

25 April, 2017 - 09:08

Experiment Description: 

injection into young adult males, checking reproduction & spermatophore attachment of females
Sample

Organism: 

Sex: 

male

Number of Individuals (Start): 

30

Developmental Stage CV: 

Adult
Target description

Primary target ID: 

Gene or target symbol: 

MLSWP1
Fragment description

Fragment length: 

527bp

Fragment concentration: 

600ng/ul

Sense sequence: 

TTACGTTGGCAATCGTCGTC

Antisense sequence: 

GAAATCAAGTGCGGCTCCA

Fragment Batch ID: 

F269

Fragment Label ID: 

F269
Validation

Efficacy of Knock Down: 

F>95%
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

male specific gene; checking for spermatophore attachment to the female

Subscribe to RSS - no spermatophore