|
Associated RNAi Experiments
Table of all RNA interference experiments conducted using this feature, grouped by Phenotype CV: -Missing-
Gallery Image |
Title |
Gene or target symbol |
Sex/Stage |
Phenotype |
Date |
|
AS F0 db injection |
CPY |
female |
-Missing- -Missing- |
21.08.2018 - 09:08 24.09.2018 - 09:08 |
|
AS F0 |
CPY |
female |
-Missing- -Missing- |
21.08.2018 - 09:08 24.09.2018 - 09:08 |
|
AX F0 |
CPY185 |
female |
normal -Missing- |
07.05.2019 - 09:00 13.06.2019 - 09:00 |
Table of all RNA interference experiments conducted using this feature, grouped by Phenotype CV: Control
Gallery Image |
Title |
Gene or target symbol |
Sex/Stage |
Phenotype |
Date |
|
AU F0 |
CPY185 |
female |
No visible phenotype Control |
01.02.2019 - 09:08 07.03.2019 - 00:00 |
|
AU F0 male |
CPY185 |
male |
No visible phenotype Control |
01.02.2019 - 09:08 07.03.2019 - 00:00 |
Properties
Property Name | Value |
Note | Negative control with (almost) no blast hits to the louse genome |
Sequences
The following sequences are available for this feature:
PCR_product sequence >CPY185 ID=CPY185|Name=CPY185 (negative control)|organism=Gadus morhua|type=PCR_product|length=849bp ggcaaccatgaagtctcttatcttcgttctgctcctcggagctgtcttcg ctgaggaggacaagatcgtcggagggtatgagtgtacgaggcactcccag gcccaccaggtgtctctgaactctggataccacttctgtggaggctccct ggtcagcaaggactgggtggtgtctgctgctcactgctacaagtcccgta ttgaggtgcgtctgggcgagcaccacatcagggtcaacgagggaaccgag cagttcatctcctcctccagcgtcatccgtcaccccaactacagctccta caacatcgacaacgacatcatgctgatcaagctgagcaagcccgccaccc tgaaccagtatgtgcagactgtggcccttcccaccgaatgtgctgctgat ggcaccatgtgcaccgtgtctggctggggaaacaccatgagctccgttga tgacggggacaagcttcagtgcctgaacctgcccatcctctcccacgccg actgttccaactcctaccctggcatgatcacccagtccatgttctgcgct ggctacctggagggaggcaaggactcctgccagggagactccggtggccc cgtggtgtgcaacggtgtgctgcagggtgttgtgtcctggggatacggat gtgctgagagggacaacccccggcgtctacgccaaggtctgcgttctctc gggctgggttcgcgataccatggcaagttattaaatgatcctcttcagat tcctgtagcagcttcacatcagnctgttaatggagaaaatgatatgatca taagtttaaanagaaatcntaaaaaaaaaaaaaaaaaaaaaaaaaaaaa back to top
|