T F166

General

End Date: 

Tuesday, December 9, 2014 (All day)

Experiment Batch ID: 

T

Start Date: 

Thursday, October 30, 2014 - 13:20

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

UN50_10071

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F166

Fragment concentration: 

600.00ng/ul

Fragment length: 

457bp

Sense sequence: 

cgaatccgcagatgaaggagtctatgacttctgggtgtctccacgtgtgggctcttatgctaaggtaatggttgctcctggatacgtttctacattcgaacaattcttgaaggagcaayccattgcctctactcttttgattgaggatgtggaaattactaatcaaagattttccatcattgaaaatgctttaagaaaaatcaaaacttcatccagatcaattgactttgaaaactactacagttcagacgatcttraagccgataatggctttgtcgaagttgaaacctatggaaaatcctacgaaggtagagacttaaaggtcatcaagattatgaaggctggacctaatgctcccaatatcttcattgaggctggaattcatgcacaagatcctgaaaatgctcgttaccttgaccaattcaatttccacatcatgccttccgttaaccccgat

Fragment Producer: 

licelab

Primer Group: 

likb2496_T7_b2546
Validation

Efficacy of Knock Down: 

F>96.00%
Phenotype

Phenotype CV: 

Phenotype: 

Abnormal

Number of Individuals (End): 

19

Gallery Image: 

Upload

Image Quality: 

0
No votes yet

 

Short and malformed eggstrings, no mortality