LsHSCARB - a putative intestinal heme receptor

General

End Date: 

Monday, May 29, 2017 - 10:10

Experiment Description: 

Knock-down of putative heme receptor

Experiment Batch ID: 

EMLSAT00000005382

Start Date: 

Tuesday, March 21, 2017 - 10:10

Experiment Contact: 

Publication: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Label ID: 

F289

Fragment concentration: 

600.00ng/ul

Fragment ID: 

Fragment length: 

731bp

Sense sequence: 

agcggataaactcgatggcttgccaaaaacagtaaaagatatttgttttgaaattataaataatggtaatgaagctctaggtattaaggccgaagatttatttattactgaagaagttgacaaaatcctatacacgggcttcgactctaagtctgctgctatctttgataaattggatacatttcttatgctcttgttagaagtcatacaagaatccttggagttggatataccaattaaagcaaaagactttgaaaacataatcaaaatcattagtcctgcacagctttcagaagggacttttgcttttttcaaaggtaaaaatgcaaccaaattgcagaattactataccattgaaaacggacggttcgataaagaaagttttatgaatattgttgagttcaatggtaagaataaattacctgaggcttggtggcctaatgtagccacaagtataacgggtcaactttcaagtgagggtggctcatgccatagaatctatggaacggatgggactcaatttccaccgtttttatttaacaagaaaaaatttcctttgtggatgtttgtgggagagctttgtagaacaatatatgtggagtttgagtccgaagtggaagtggaaggagggatcacagcctatcgttatggagtagggaagagagttttctcaatgagtaaccctgaaaacttttgttattgtcaagaatttttctcatgcgccaagcaaa
Validation

Efficacy of Knock Down: 

F>95.00%
Phenotype

Phenotype CV: 

Phenotype: 

Shorter egg-strings, 60% less heme, lower hatching rate

Number of Individuals (End): 

15

Gallery Image: 

Image file: 

Upload

Image Quality: 

5
Average: 5 (1 vote)

Knock-down of putative heme receptor (scavenger receptor) in adult female louse intestines.