LsHSCARB - a putative intestinal heme receptor

General

End Date: 

Monday, May 29, 2017 - 10:10

Experiment Description: 

Knock-down of putative heme receptor

Experiment Batch ID: 

EMLSAT00000005382

Start Date: 

Tuesday, March 21, 2017 - 10:10

Experiment Contact: 

Publication: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Label ID: 

F289

Fragment concentration: 

600.00ng/ul

Fragment ID: 

Fragment length: 

731bp

Sense sequence: 

agcggataaactcgatggcttgccaaaaacagtaaaagatatttgttttgaaattataaataatggtaatgaagctctaggtattaaggccgaagatttatttattactgaagaagttgacaaaatcctatacacgggcttcgactctaagtctgctgctatctttgataaattggatacatttcttatgctcttgttagaagtcatacaagaatccttggagttggatataccaattaaagcaaaagactttgaaaacataatcaaaatcattagtcctgcacagctttcagaagggacttttgcttttttcaaaggtaaaaatgcaaccaaattgcagaattactataccattgaaaacggacggttcgataaagaaagttttatgaatattgttgagttcaatggtaagaataaattacctgaggcttggtggcctaatgtagccacaagtataacgggtcaactttcaagtgagggtggctcatgccatagaatctatggaacggatgggactcaatttccaccgtttttatttaacaagaaaaaatttcctttgtggatgtttgtgggagagctttgtagaacaatatatgtggagtttgagtccgaagtggaagtggaaggagggatcacagcctatcgttatggagtagggaagagagttttctcaatgagtaaccctgaaaacttttgttattgtcaagaatttttctcatgcgccaagcaaa
Validation

Efficacy of Knock Down: 

F>95.00%
Phenotype

Phenotype CV: 

Phenotype: 

Shorter egg-strings, 60% less heme, lower hatching rate

Number of Individuals (End): 

15

Gallery Image: 

Image file: 

Upload

Image Quality: 

5
Average: 5 (1 vote)

Characterization of a putative intestinal heme scavenger.

Experiment terminated at control lice's 5 pair of egg-strings. We only start to see a phenotypic change at the 2nd and 3rd pair of egg-strings (not shown here). Treated lice had shorter egg-strings with a lower hatching rate, and the adult females had about 60% less heme (measured with fluorescence). Animals were disected into two poritons. We measured down-regulation by RNAi in the intestinal tissue and heme levels were measured in the remaining body tissues. See Materials&Methods for details.