feeding

RNAi_AS 11369+12062

Phenotype CV: 

General

Experiment Batch ID: 

RNAi_AS

Experiment Contact: 

Start Date: 

21 August, 2017 - 13:24

End Date: 

24 September, 2018 (All day)
Sample

Organism: 

Sex: 

female

Developmental Stage CV: 

preadult II femal
Target description
Fragment description

Fragment Label ID: 

F389
Validation

Efficacy of Knock Down: 

F>90%
Upload

Image Quality: 

0
No votes yet

developmenta details, no egg-strings, no gut contant. All genes downregulated by around 90%

RNAi_AS 11366+11369+10832

Phenotype CV: 

General

Experiment Batch ID: 

RNAi_AS

Experiment Contact: 

Start Date: 

21 August, 2017 - 13:24

End Date: 

24 September, 2018 (All day)

Experiment Description: 

Sample

Organism: 

Sex: 

female

Developmental Stage CV: 

preadult II femal
Target description
Fragment description

Sense sequence: 

Antisense sequence: 

Fragment Batch ID: 

Fragment Label ID: 

F388

Fragment Mixture Formula: 

Fragment Producer: 

Validation

Efficacy of Knock Down: 

F>90%
Phenotype

Phenotype: 

Upload

Image Quality: 

0
No votes yet

developmenta details, no egg-strings, no gut contant. All genes downregulated by around 90%

RNAi_AN 10832+11366+11369+12062

Phenotype CV: 

General

Experiment Batch ID: 

RNAi_AN

Experiment Contact: 

Start Date: 

1 November, 2017 - 13:24

End Date: 

3 January, 2018 (All day)
Sample

Organism: 

Sex: 

both

Developmental Stage CV: 

preadult I male
preadult I female
Target description
Fragment description

Fragment Label ID: 

F345
Validation

Efficacy of Knock Down: 

F>90%
Upload

Image Quality: 

0
No votes yet

delevlopmental defects, empty intestine, no egg strings

LsHSCARB - a putative intestinal heme receptor

Phenotype CV: 

General

Experiment Batch ID: 

EMLSAT00000005382

Experiment Contact: 

Start Date: 

21 March, 2017 - 10:10

End Date: 

29 May, 2017 - 10:10

Experiment Description: 

Knock-down of putative heme receptor
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description
Fragment description

Fragment length: 

731bp

Fragment concentration: 

600ng/ul

Sense sequence: 

agcggataaactcgatggcttgccaaaaacagtaaaagatatttgttttgaaattataaataatggtaatgaagctctaggtattaaggccgaagatttatttattactgaagaagttgacaaaatcctatacacgggcttcgactctaagtctgctgctatctttgataaattggatacatttcttatgctcttgttagaagtcatacaagaatccttggagttggatataccaattaaagcaaaagactttgaaaacataatcaaaatcattagtcctgcacagctttcagaagggacttttgcttttttcaaaggtaaaaatgcaaccaaattgcagaattactataccattgaaaacggacggttcgataaagaaagttttatgaatattgttgagttcaatggtaagaataaattacctgaggcttggtggcctaatgtagccacaagtataacgggtcaactttcaagtgagggtggctcatgccatagaatctatggaacggatgggactcaatttccaccgtttttatttaacaagaaaaaatttcctttgtggatgtttgtgggagagctttgtagaacaatatatgtggagtttgagtccgaagtggaagtggaaggagggatcacagcctatcgttatggagtagggaagagagttttctcaatgagtaaccctgaaaacttttgttattgtcaagaatttttctcatgcgccaagcaaa

Fragment ID: 

Fragment Label ID: 

F289
Validation

Efficacy of Knock Down: 

F>95%
Phenotype

Number of Individuals (End): 

15

Phenotype: 

Shorter egg-strings, 60% less heme, lower hatching rate
Upload

Image file: 

Gallery Image: 

Image Quality: 

5
Average: 5 (1 vote)

Knock-down of putative heme receptor (scavenger receptor) in adult female louse intestines.

C F4 (CopB2)

Phenotype CV: 

General

Experiment Batch ID: 

C

Experiment Contact: 

Start Date: 

14 August, 2012 - 09:00

End Date: 

24 September, 2012 - 09:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

LsCopB2
Fragment description

Fragment length: 

566bp

Fragment concentration: 

600ng/ul

Sense sequence: 

atcgtgtcaagtccacagacctgcacccagtggagccttggatgttggcctcgctctacaacgggaacgtgcacatttggaactacgagtctcagcagttggtcaagtccctggaggtgtgcgacttgccggtgcgagccgccaagtttgtgagccgtaagaattgggtggtgacgggttctgacgacatgaagctgaatgtgttcaactacaacaccctggagcgtgtgtcttgcctggaggcgcactctgactatctgcggtccctggccgtccacccgagtgagcccctggtcctctcctcctcggacgacatgctcattaagctctggaactgggacaaggcctgggcctgtgaacaggtcttcgagggacacacgcactacataatgcaagtggtcatcaaccccaaggacaacaacacttttgcctccgcctctttggaccgcaccatcaaggtctggcacttgggcgcatcttgccccaacttcactctggagggacatgacaagggcgtcaactgtctggactactaccacgccggggacaagccctacctcatctcg

Fragment Label ID: 

F4

Primer Group: 

b671

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>82%
Phenotype

Number of Individuals (End): 

0
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of LsCopB2 in preadult female lice. Early termination after 15 days (Rack 4a and 4b - no survivors in 4c at normal termination date). High mortality, empty gut, no egg strings, underdeveloped genital segment and abdomen.

A F4 (CopB2)

Phenotype CV: 

General

Experiment Batch ID: 

A

Experiment Contact: 

Start Date: 

23 January, 2012 - 09:00

End Date: 

24 February, 2012 - 09:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

LsCopB2
Fragment description

Fragment length: 

566bp

Fragment concentration: 

600ng/ul

Sense sequence: 

atcgtgtcaagtccacagacctgcacccagtggagccttggatgttggcctcgctctacaacgggaacgtgcacatttggaactacgagtctcagcagttggtcaagtccctggaggtgtgcgacttgccggtgcgagccgccaagtttgtgagccgtaagaattgggtggtgacgggttctgacgacatgaagctgaatgtgttcaactacaacaccctggagcgtgtgtcttgcctggaggcgcactctgactatctgcggtccctggccgtccacccgagtgagcccctggtcctctcctcctcggacgacatgctcattaagctctggaactgggacaaggcctgggcctgtgaacaggtcttcgagggacacacgcactacataatgcaagtggtcatcaaccccaaggacaacaacacttttgcctccgcctctttggaccgcaccatcaaggtctggcacttgggcgcatcttgccccaacttcactctggagggacatgacaagggcgtcaactgtctggactactaccacgccggggacaagccctacctcatctcg

Fragment Label ID: 

F4

Primer Group: 

b671

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>65%
Phenotype

Number of Individuals (End): 

5
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of LsCopB2 in preadult female lice. High mortality, empty gut, no egg strings, underdeveloped genital segment and abdomen.

E F42

Phenotype CV: 

General

Experiment Batch ID: 

E

Experiment Contact: 

Start Date: 

15 October, 2012 - 10:19

End Date: 

26 November, 2012 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

g13677_Rheb
Fragment description

Fragment length: 

460bp

Fragment concentration: 

600ng/ul

Sense sequence: 

atggggcctcccaagtctcgtaaaattgccttaatgggagctgtttccgtgggcaaatcttctctggccatccaatttgtacaaggacaatttgtcgattcctacgaaccaacaatcgaaaatacatttaccaaaacagttaaaattaatagacaagaatatgaaatttgtcttgttgatacagcaggccaaaatgaatactctatctttccattggaatattctgtaggaatagatggatatgttcttgtatactccattgattcacctaaaagcttagaagtttgtcaaatcatacaggaaaaattaatagaattcacaggaaacccaaatgttcccattgtcttggttggcaataaaaatgatttgtatatggaaagatatgtttcctttgaagaaggcaaaagaagagctgaagaaatgaaagcagtgtttcttgagacctctgccaaggaaaacc

Fragment Label ID: 

F42

Primer Group: 

Rheb_f_b1063

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>60%
Phenotype

Number of Individuals (End): 

25

Phenotype: 

Low reproduction and most are missing blood in the gut
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Downregulation of Rheb

Subscribe to RSS - feeding