Rhabdovirus - No9+127 prod of virus free strain

General

Experiment Description: 

Test if it is possible to cure lice for two rhabdovirus simultaneously. Used lice taken from Hardanger fjord that was infected with both LsRV-No9 and No127 strains. Treatment given at Nauplius I and pre-adult stage. Copepods (80/fish) were given to 6 fish, and sampled at 25 days post infestation. Pre-adult lice were given 600 ng/ul dsRNA by injection and sampled at 75 dpi. The offspring of these females were treated with dsRNA at Nauplius I and pre-adult stage as described above, and adult lice were sampled at 55 dpi.

Experiment Batch ID: 

Exp5

Start Date: 

Monday, January 16, 2017 - 14:11

Experiment Contact: 

Publication: 

Sample

Developmental Stage CV: 

Nauplius I
Adult

Number of Individuals (Start): 

480

Sex: 

unknown

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

FNo9
FNo127

Fragment concentration: 

3000.00ng/ul

Fragment length: 

896bp

Sense sequence: 

>No9: ttctcccggaccgacatggaaacagagtttcatgttaatctatccaagcccggtattcaatcacaatatccatctgagtggttttctgctggaaacaaaaggcccagtgtgtccgtgaaggtcccaacaacgtatctgaaaaaggagtcaagagattacttttgtaatctcctaaacaactcattgacagtccccgaatggtcaacgatccaagggatggtctggctctcggagatgtatcctagtcaactgaaggggaatgatgtactagagtcattcgggataaagttaactgatgataaaaaccaggtgacggtcaaatcaattcttaactatgccgaggtagaggatcccactactacactcaaacccccagccaacaacaaaacagaatggactgaccaggagtactttgtcgggattacggcagtactggtcagttaccggtatcacagacttgtgcacgaggaggggagggaggccttactgagaagattagccggaatgctgacatctcaaacgctaagccttgcgtctattgttcggaaagccctcccagaacccggcgaagacatgaggaaggttatggcagcgctagatctccagttcaaccttggagatgggaaccccgaattcaaaagagtcaggatggggacagttcatctgcttcagagggatcagacatttctaagtgaagttcttgccatatctggttggtttgggaccgagtcctatgaaatgatcaaatggattttctctgccgaggtagcgaaggaggtcagagatagattttctcatgcagacgaggaagcaggacaacaattttcttactctgcctatatgattgatttcgggatttccaacagatctccttactcagtcaccgccaatccctt >No127: ggagccatcggaggttatgacctgggtgactcttgattccgtctcgactgagatcttgaagaccgtcagagatactgaggaaatttattgtcctttctcttatgccccctatatgatggatctcgggatatcagctaagtctccgtattcggtcacagaaaatcctttgtctcacctatggattcatgtgacaggagtaatattaaataacccgcgatctatgaatgcccggattatcggggagaccacatttcatcaggtaattttgtcctccgccctcctggcttatcggtgcgcaacaagtcctttattgagtcaaaagttcagtggacaatccgacctcagaggggtagaagagagtattagggtcttgtcggagtcaagttcatatttctcaaacactgaggatcttgatctggaagacgatccacaacaaaacactcccatggcatacgtcgcttggtgtgacaacaagtggaaccgtcgactttttacatttgtagactccgcaatgctaggattgacacggcccctt

Fragment Mixture Formula: 

FNo9+FNo127

Fragment Producer: 

Aina-Cathrine Øvergård
Validation

Efficacy of Knock Down: 

F>100.00%
Phenotype

Phenotype CV: 

Upload

Image Quality: 

0
No votes yet

n