LsRhabNo9.nucleoprotein.g, KJ958535.nucleoprotein.g (gene) Lepeophtheirus salmonis rhabdovirus No 9

Overview
NameLsRhabNo9.nucleoprotein.g
Unique NameKJ958535.nucleoprotein.g
Typegene
OrganismLepeophtheirus salmonis rhabdovirus No 9 (Lepeophtheirus salmonis rhabdovirus No9)
Associated RNAi Experiments
Table of all RNA interference experiments conducted using this feature, grouped by Phenotype CV: -Missing-
Gallery Image Title Gene or target symbol Sex/Stage Phenotype Datesort descending Publication
Rhabdovirus - No9 prod of virus free strains N protein LsRV-No9 unknown
  1. Nauplius I
  2. Adult
-Missing-
-Missing-
02.02.2015 - 14:11
RNAi-mediated treatment of two vertically... more
Rhabdovirus - No9 prod of virus free strains N protein LsRV-No9 unknown
  1. Nauplius I
  2. Adult
-Missing-
-Missing-
02.02.2015 - 14:11
RNAi-mediated treatment of two vertically... more
Rhabdovirus - No9+127 Specificity N protein LsRV-No9, N protein LsRV-No127 unknown
  1. Nauplius I
  2. Copepodid
-Missing-
-Missing-
19.04.2015 - 14:11
RNAi-mediated treatment of two vertically... more
Table of all RNA interference experiments conducted using this feature, grouped by Phenotype CV: no visible phenotype
Gallery Image Title Gene or target symbol Sex/Stage Phenotype Datesort descending Publication
Rhabdovirus - No9+127 prod of virus free strain N protein LsRV-No9, N protein LsRV-No127 unknown
  1. Nauplius I
  2. Adult
-Missing-
no visible phenotype
16.01.2017 - 14:11
RNAi-mediated treatment of two vertically... more
Rhabdovirus - No9+127 prod of virus free strain N protein LsRV-No9, N protein LsRV-No127 unknown
  1. Nauplius I
  2. Adult
-Missing-
no visible phenotype
16.01.2017 - 14:11
RNAi-mediated treatment of two vertically... more
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
KJ958535viral_sequenceKJ958535:155..1648 +
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GenBank2017-12-04 .396135
Properties
Property NameValue
NoteN-protein
Productnucleoprotein
Codon start1
Protein idAIY25907.1
Translationlength.497
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
LsRhabNo9.nucleoprotein.tKJ958535.nucleoprotein.tLepeophtheirus salmonis rhabdovirus No 9mRNA


Sequences
The following sequences are available for this feature:

gene from alignment at KJ958535:155..1648+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KJ958535.nucleoprotein.g ID=KJ958535.nucleoprotein.g|Name=LsRhabNo9.nucleoprotein.g|organism=Lepeophtheirus salmonis rhabdovirus No 9|type=gene|length=1494bp|location=Sequence derived from alignment at KJ958535:155..1648+ (Lepeophtheirus salmonis rhabdovirus No 9)
ATGGCAGCCAAACATCCCGAATCAATCAACATCAACAAAGGACCCGGCGC AAGTCCGGCTCTATTCTCCCGGACCGACATGGAAACAGAGTTTCATGTTA ATCTATCCAAGCCCGGTATTCAATCACAATATCCATCTGAGTGGTTTTCT GCTGGAAACAAAAGGCCCAGTGTGTCCGTGAAGGTCCCAACAACGTATCT GAAAAAGGAGTCAAGAGATTACTTTTGTAATCTCCTAAACAACTCATTGA CAGTCCCCGAATGGTCAACGATCCAAGGGATGGTCTGGCTCTCGGAGATG TATCCTAGTCAACTGAAGGGGAATGATGTACTAGAGTCATTCGGGATAAA GTTAACTGATGATAAAAACCAGGTGACGGTCAAATCAATTCTTAACTATG CCGAGGTAGAGGATCCCACTACTACACTCAAACCCCCAGCCAACAACAAA ACAGAATGGACTGACCAGGAGTACTTTGTCGGGATTACGGCAGTACTGGT CAGTTACCGGTATCACAGACTTGTGCACGAGGAGGGGAGGGAGGCCTTAC TGAGAAGATTAGCCGGAATGCTGACATCTCAAACGCTAAGCCTTGCGTCT ATTGTTCGGAAAGCCCTCCCAGAACCCGGCGAAGACATGAGGAAGGTTAT GGCAGCGCTAGATCTCCAGTTCAACCTTGGAGATGGGAACCCCGAATTCA AAAGAGTCAGGATGGGGACAGTTCATCTGCTTCAGAGGGATCAGACATTT CTAAGTGAAGTTCTTGCCATATCTGGTTGGTTTGGGACCGAGTCCTATGA AATGATCAAATGGATTTTCTCTGCCGAGGTAGCGAAGGAGGTCAGAGATA GATTTTCTCATGCAGACGAGGAAGCAGGACAACAATTTTCTTACTCTGCC TATATGATTGATTTCGGGATTTCCAACAGATCTCCTTACTCAGTCACCGC CAATCCCTTATTCCACATGTGGGTCCATATCATTGGAGTACTCCTAGGGA AAGTCAGATCTTACAATGCGATCCAGTTAGAAGACGGCTTGATCGGACGA TATTTCCTGGCCTCAGCTCTGACAGCCTTCAGATGGTCCCAATCCAGTAC ACTAGACACCCAGATCTTTGAGAAGATTGTACGAGATGATATTCAGGAAG AGTACAACAATAAAAGAAAAAATAGAGATTTGCTGGAGCATCAGCTAGGA CCAGGAGGAGAAGAAGACTTTGCAGACGACTTCTCTGAAGACTCCGATGA CGATGAGGATACCATCAGGAAAAAGATAAGGACTCCCAGGGAAGCTGTAG CATGGTGTGGGGGGGTCTGGAAGAGACCGTTGTTTGAATGGGTGGACGGA ACTTTGTCTTCCAAAGTTCATAATATGAGACAAGGATCCATGGGAAGAGC AGTCAGGGAGTACTGGAAAAGCAACAGATCCTCCATCAACAGAGACAGAT GGATTCTGACACCTTGGGACGAGGGCCACTCCTCGTCCTATTGA
back to top
Add to Basket