Rhabdovirus - No9+127 prod of virus free strain


Experiment Description: 

Test if it is possible to cure lice for two rhabdovirus simultaneously. Used lice taken from Hardanger fjord that was infected with both LsRV-No9 and No127 strains. Treatment given at Nauplius I and pre-adult stage. Copepods (80/fish) were given to 6 fish, and sampled at 25 days post infestation. Pre-adult lice were given 600 ng/ul dsRNA by injection and sampled at 55 dpi.

Experiment Batch ID: 


Start Date: 

Monday, January 16, 2017 - 14:11

Experiment Contact: 



Developmental Stage CV: 

Nauplius I

Number of Individuals (Start): 





Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 


Fragment concentration: 


Fragment length: 


Sense sequence: 

No9: ttctcccggaccgacatggaaacagagtttcatgttaatctatccaagcccggtattcaatcacaatatccatctgagtggttttctgctggaaacaaaaggcccagtgtgtccgtgaaggtcccaacaacgtatctgaaaaaggagtcaagagattacttttgtaatctcctaaacaactcattgacagtccccgaatggtcaacgatccaagggatggtctggctctcggagatgtatcctagtcaactgaaggggaatgatgtactagagtcattcgggataaagttaactgatgataaaaaccaggtgacggtcaaatcaattcttaactatgccgaggtagaggatcccactactacactcaaacccccagccaacaacaaaacagaatggactgaccaggagtactttgtcgggattacggcagtactggtcagttaccggtatcacagacttgtgcacgaggaggggagggaggccttactgagaagattagccggaatgctgacatctcaaacgctaagccttgcgtctattgttcggaaagccctcccagaacccggcgaagacatgaggaaggttatggcagcgctagatctccagttcaaccttggagatgggaaccccgaattcaaaagagtcaggatggggacagttcatctgcttcagagggatcagacatttctaagtgaagttcttgccatatctggttggtttgggaccgagtcctatgaaatgatcaaatggattttctctgccgaggtagcgaaggaggtcagagatagattttctcatgcagacgaggaagcaggacaacaattttcttactctgcctatatgattgatttcgggatttccaacagatctccttactcagtcaccgccaatccctt No127: ggagccatcggaggttatgacctgggtgactcttgattccgtctcgactgagatcttgaagaccgtcagagatactgaggaaatttattgtcctttctcttatgccccctatatgatggatctcgggatatcagctaagtctccgtattcggtcacagaaaatcctttgtctcacctatggattcatgtgacaggagtaatattaaataacccgcgatctatgaatgcccggattatcggggagaccacatttcatcaggtaattttgtcctccgccctcctggcttatcggtgcgcaacaagtcctttattgagtcaaaagttcagtggacaatccgacctcagaggggtagaagagagtattagggtcttgtcggagtcaagttcatatttctcaaacactgaggatcttgatctggaagacgatccacaacaaaacactcccatggcatacgtcgcttggtgtgacaacaagtggaaccgtcgactttttacatttgtagactccgcaatgctaggattgacacggcccctt

Fragment Mixture Formula: 


Fragment Producer: 

Aina-Cathrine Øvergård

Efficacy of Knock Down: 


Phenotype CV: 


Image Quality: 

No votes yet

Knock-down females: No9=98%, No127=97%