AL F338

General

End Date: 

Friday, October 6, 2017 - 10:00

Experiment Description: 

Knockdown of the nuclear receptor Fushi tarazu factor 1 (FTZF1)

Experiment Batch ID: 

RNA_AL

Start Date: 

Monday, August 28, 2017 - 10:00

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F338

Fragment Batch ID: 

F338

Fragment ID: 

Fragment length: 

467bp

Sense sequence: 

cgccttcatcatcgacaacaacatccatactaacctcatctacaaataaaaaacctcgttccctcaaaatcgtcgaatgtctcgactct tcctcgacgacacacaccacagcctctccatcgtcgccatcaacctcttcatggaatctc Attcttccttcgcatccttccgtagaatcaccttcatcgtcttcgagtccttctcatcaa Ggagggggagataaagagatatcctctgtggttatagcagcctctacgaccacgacagca Actaaaagatcatttagtcaacatatcatggaagaagaggaagaggacgaagacgaagaa Gaggctggaggacacttatcttggaaccctgatgaagagcaggatcaatcagctgaggag Gatgcaggactaccaacagcatccagtaacaacaactccgctggatccacatccggagacttcggtcctggagttgtg

Fragment Producer: 

licelab
Validation

Efficacy of Knock Down: 

F>45.00%
Phenotype

Phenotype CV: 

Phenotype: 

No eggstrings

Number of Individuals (End): 

12

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Knockdown of the nuclear FTZ-F1 in pre-adult 2. Knockdown resulted in strange genital segments. Sectioning revealed disorganization of eggs in genital segment.