AL F339


End Date: 

Friday, October 6, 2017 - 00:00

Experiment Description: 

Knockdown of the nuclear receptor FTZF1

Experiment Batch ID: 


Start Date: 

Monday, August 28, 2017 - 10:00

Experiment Contact: 


Developmental Stage CV: 


Number of Individuals (Start): 





Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 


Fragment Batch ID: 


Fragment ID: 

Fragment length: 


Sense sequence: 

gtgatagggcacggaaactgcaagtcttgcgt Caaagacaagtgatacacggtggagtttccatgggcccaagtagcatgaataatacgaca Accacaacgagtagtagtgcatcctacggcggcggtgcctccggtggaatgaactccacg Agtagccctccatccatgaacaataataataataacaattccccctcaatctacggctca Cccatcactcatattaaacaagagatacaaataccacaagtcacatctatgacgtcttca Ccagatacttcaccctctcccgttcatttacccggaatgatttctaatcctggaggcaat Ccaatgggtggagatactccgggctccaatcccatcattgcccaacagactgatcctgcc Ggaggtattcaatggcagatcaatgctgctggaaagcatcaggatatccaaagtaatcaa Ggaactgggaaaatgccagccatcattcgagaattccttgcctccct

Fragment Producer: 


Efficacy of Knock Down: 


Phenotype CV: 


No eggstrings

Number of Individuals (End): 


Gallery Image: 

Image file: 


Image Quality: 

No votes yet

Knockdown of FTZF1 targetting both isoforms, alpha and beta. Only alpha is downregulated, few survivors. Sectioning reveals disorganization of eggs in genital segment, resulting in no eggstrings, same as probe F338 (other entry).