AL F339

General

End Date: 

Friday, October 6, 2017 (All day)

Experiment Description: 

Knockdown of the nuclear receptor FTZF1

Experiment Batch ID: 

RNA_AL

Start Date: 

Monday, August 28, 2017 - 10:00

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F339

Fragment Batch ID: 

F339

Fragment ID: 

Fragment length: 

499bp

Sense sequence: 

gtgatagggcacggaaactgcaagtcttgcgt Caaagacaagtgatacacggtggagtttccatgggcccaagtagcatgaataatacgaca Accacaacgagtagtagtgcatcctacggcggcggtgcctccggtggaatgaactccacg Agtagccctccatccatgaacaataataataataacaattccccctcaatctacggctca Cccatcactcatattaaacaagagatacaaataccacaagtcacatctatgacgtcttca Ccagatacttcaccctctcccgttcatttacccggaatgatttctaatcctggaggcaat Ccaatgggtggagatactccgggctccaatcccatcattgcccaacagactgatcctgcc Ggaggtattcaatggcagatcaatgctgctggaaagcatcaggatatccaaagtaatcaa Ggaactgggaaaatgccagccatcattcgagaattccttgcctccct

Fragment Producer: 

licelab
Validation

Efficacy of Knock Down: 

F>45.00%
Phenotype

Phenotype CV: 

Phenotype: 

No eggstrings

Number of Individuals (End): 

7

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Knockdown of FTZF1 targetting both isoforms, alpha and beta. Only alpha is downregulated, few survivors. Sectioning reveals disorganization of eggs in genital segment, resulting in no eggstrings, same as probe F338 (other entry).