AS F379

General

End Date: 

Monday, September 24, 2018 - 09:08

Experiment Description: 

Knockdown of one cement-gland gene.

Experiment Batch ID: 

AS

Start Date: 

Tuesday, August 21, 2018 - 09:08

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

EMLSAT00000008518

Primary target ID: 

Fragment description

Fragment Label ID: 

F379

Fragment Batch ID: 

F379

Fragment concentration: 

600.00ng/ul

Fragment length: 

483bp

Sense sequence: 

GGACGGTGTGTGACTCCAAACACCTGCAAGTGTGATTCTGGGTGGAGGGGTGATACCTGCAATGAGTGTATTCCCTCATCTCAGTGTCAAAATGGATTTTGCGTTCATTCTCCGAAGGAATGTATCTGCAGTTTGGGCTGGGCTGGAGTAAACTGTGATCTACAGGATCATGGATGTGTCCATGGAACCTTTTCATCAAAACATCACTGCACATGCGATCCGGGATGGTTAGGAAGAAATTGCAGTTCTTGTATACCGCACCCAAGTTGTGTTTGGGGATCATGTAAATCCACTCCGGGCGAATGTTTTTGTGATCCAGGATGGGATGGAAGGAATTGTGACATCCCCATTTGCGAGAAAGGGTGTCATCCAGATCACGGATTTTGTTTTAAGCCATCTCAATGTATATGTCGCTCTGGTTGGCATGGAAAACGTTGTGATCTTTGCACTCCAATGCCTGGATGCACACGAGGATGCCATAAA
Validation

Efficacy of Knock Down: 

F>90.00%
Phenotype

Phenotype CV: 

Number of Individuals (End): 

15

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

knockdown lead to missing egg strings