
Affecting the reproduction in any way.

AV F404

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

14 March, 2019 - 08:35

End Date: 

24 April, 2019 - 08:23

Experiment Description: 

injection into pradult females




Number of Individuals (Start): 


Developmental Stage CV: 

Target description
Fragment description

Fragment length: 


Fragment concentration: 


Sense sequence: 


Antisense sequence: 


Fragment Label ID: 


Fragment Mixture Formula: 

50% of both, in total 600 ng/ul

Fragment Producer: 


Fragment Producer Contact: 


Efficacy of Knock Down: 


Number of Individuals (End): 


Image file: 

Gallery Image: 

Image Quality: 

No votes yet

Knockdown of a testis-specific ion-pump in pre-adult1 males, checking reproduction in adults. Many males were lost, and no kncokdown observed.

AS F384

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

21 August, 2018 - 09:08

End Date: 

24 September, 2018 - 09:08

Experiment Description: 

Knockdown of one cement-gland gene.




Number of Individuals (Start): 


Developmental Stage CV: 

Target description
Fragment description

Fragment concentration: 


Fragment Batch ID: 


Fragment Label ID: 


Fragment Mixture Formula: 

F381+F382+F383 in same ratio

Efficacy of Knock Down: 


Number of Individuals (End): 


Image file: 

Gallery Image: 

Image Quality: 

No votes yet

knockdown lead to missing egg strings

AS F380

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

21 August, 2018 - 09:08

End Date: 

24 September, 2018 - 09:08

Experiment Description: 

Knockdown of one cement-gland gene.




Number of Individuals (Start): 


Developmental Stage CV: 

Target description

Primary target ID: 

Gene or target symbol: 

Fragment description

Fragment length: 


Fragment concentration: 


Sense sequence: 


Fragment Batch ID: 


Fragment Label ID: 


Efficacy of Knock Down: 


Number of Individuals (End): 


Image file: 

Gallery Image: 

Image Quality: 

No votes yet

knockdown lead to missing egg strings

AS F379

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

21 August, 2018 - 09:08

End Date: 

24 September, 2018 - 09:08

Experiment Description: 

Knockdown of one cement-gland gene.




Number of Individuals (Start): 


Developmental Stage CV: 

Target description

Primary target ID: 

Gene or target symbol: 

Fragment description

Fragment length: 


Fragment concentration: 


Sense sequence: 


Fragment Batch ID: 


Fragment Label ID: 


Efficacy of Knock Down: 


Number of Individuals (End): 


Image file: 

Gallery Image: 

Image Quality: 

No votes yet

knockdown lead to missing egg strings

AP F367 EMLSAG00000005299

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

6 March, 2018 - 09:00

End Date: 

10 April, 2018 - 09:00

Experiment Description: 

EMLSAG1458 knock-down




Number of Individuals (Start): 


Developmental Stage CV: 

Target description

Primary target ID: 

Gene or target symbol: 

Fragment description

Fragment length: 


Fragment concentration: 


Sense sequence: 

>F367 gtatgatgacggacatgctcaagggtaacattactaacatgttgccaatgattgtaattggaggatggatcaactggcatttctcaggctttgtcactaccaaaatcccttttcccctcactcttcgtttcaagcctatgcttcaaagaggcattgaactcatgagtctagatgcttcatgggtctcctccgcctcctggtactttcttaacgttttcggactacgatctatttatgacttagttctcggagaaaataatgttgcggatcaatcaagaatcatgcaggaccagatgatgatgcctgccaacggaatggctaccgactataaacaggcc

Fragment Label ID: 


Primer Group: 


Fragment Producer: 


Fragment Producer Contact: 


Efficacy of Knock Down: 


Number of Individuals (End): 



slightly shorter gonade and abdominal segment

Image Quality: 

No votes yet

Testing the fragment for Mvp1 knock-down.

Nauplii I 12262+22100+4547+12296+12453

Phenotype CV: 


Experiment Batch ID: 


Experiment Contact: 

Start Date: 

1 February, 2016 - 14:42

End Date: 

10 February, 2016 - 01:43




Developmental Stage CV: 

Nauplius I
Target description
Fragment description

Fragment Label ID: 



reproductive defect as adults

Image Quality: 

No votes yet
Subscribe to RSS - reproduction