reproduction

Affecting the reproduction in any way.

AV F404

Phenotype CV: 

General

Experiment Batch ID: 

AV

Experiment Contact: 

Start Date: 

14 March, 2019 - 08:35

End Date: 

24 April, 2019 - 08:23

Experiment Description: 

injection into pradult females
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult1
Adult
Target description
Fragment description

Fragment length: 

400bp

Fragment concentration: 

600ng/ul

Sense sequence: 

TGTTGGCCCTATGAGTCCATCT TTTTTGTGACTTTGATGCCTTGA

Antisense sequence: 

TGATCCTTGGAAGAAAAGAGGATG TTCATCATTTCCAGCATTGAGTTT

Fragment Label ID: 

F404

Fragment Mixture Formula: 

50% of both, in total 600 ng/ul

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>50%
Phenotype

Number of Individuals (End): 

15
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of a testis-specific ion-pump in pre-adult1 males, checking reproduction in adults. Many males were lost, and no kncokdown observed.

AS F384

Phenotype CV: 

General

Experiment Batch ID: 

AS

Experiment Contact: 

Start Date: 

21 August, 2018 - 09:08

End Date: 

24 September, 2018 - 09:08

Experiment Description: 

Knockdown of one cement-gland gene.
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description
Fragment description

Fragment concentration: 

600ng/ul

Fragment Batch ID: 

F384

Fragment Label ID: 

F384

Fragment Mixture Formula: 

F381+F382+F383 in same ratio
Validation

Efficacy of Knock Down: 

F>99%
Phenotype

Number of Individuals (End): 

21
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

knockdown lead to missing egg strings

AS F379

Phenotype CV: 

General

Experiment Batch ID: 

AS

Experiment Contact: 

Start Date: 

21 August, 2018 - 09:08

End Date: 

24 September, 2018 - 09:08

Experiment Description: 

Knockdown of one cement-gland gene.
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

EMLSAT00000008518
Fragment description

Fragment length: 

483bp

Fragment concentration: 

600ng/ul

Sense sequence: 

GGACGGTGTGTGACTCCAAACACCTGCAAGTGTGATTCTGGGTGGAGGGGTGATACCTGCAATGAGTGTATTCCCTCATCTCAGTGTCAAAATGGATTTTGCGTTCATTCTCCGAAGGAATGTATCTGCAGTTTGGGCTGGGCTGGAGTAAACTGTGATCTACAGGATCATGGATGTGTCCATGGAACCTTTTCATCAAAACATCACTGCACATGCGATCCGGGATGGTTAGGAAGAAATTGCAGTTCTTGTATACCGCACCCAAGTTGTGTTTGGGGATCATGTAAATCCACTCCGGGCGAATGTTTTTGTGATCCAGGATGGGATGGAAGGAATTGTGACATCCCCATTTGCGAGAAAGGGTGTCATCCAGATCACGGATTTTGTTTTAAGCCATCTCAATGTATATGTCGCTCTGGTTGGCATGGAAAACGTTGTGATCTTTGCACTCCAATGCCTGGATGCACACGAGGATGCCATAAA

Fragment Batch ID: 

F379

Fragment Label ID: 

F379
Validation

Efficacy of Knock Down: 

F>90%
Phenotype

Number of Individuals (End): 

15
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

knockdown lead to missing egg strings

AP F367 EMLSAG00000005299

Phenotype CV: 

General

Experiment Batch ID: 

AP

Experiment Contact: 

Start Date: 

6 March, 2018 - 09:00

End Date: 

10 April, 2018 - 09:00

Experiment Description: 

EMLSAG1458 knock-down
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

EMLSAG00000005299
Fragment description

Fragment length: 

338bp

Fragment concentration: 

600ng/ul

Sense sequence: 

>F367 gtatgatgacggacatgctcaagggtaacattactaacatgttgccaatgattgtaattggaggatggatcaactggcatttctcaggctttgtcactaccaaaatcccttttcccctcactcttcgtttcaagcctatgcttcaaagaggcattgaactcatgagtctagatgcttcatgggtctcctccgcctcctggtactttcttaacgttttcggactacgatctatttatgacttagttctcggagaaaataatgttgcggatcaatcaagaatcatgcaggaccagatgatgatgcctgccaacggaatggctaccgactataaacaggcc

Fragment Label ID: 

F367

Primer Group: 

likb2502_T7_b2515

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>16%
Phenotype

Number of Individuals (End): 

24

Phenotype: 

slightly shorter gonade and abdominal segment
Upload

Image Quality: 

0
No votes yet

Testing the fragment for Mvp1 knock-down.

Nauplii I 12262+22100+4547+12296+12453

Phenotype CV: 

General

Experiment Batch ID: 

N

Experiment Contact: 

Start Date: 

1 February, 2016 - 14:42

End Date: 

10 February, 2016 - 01:43
Sample

Organism: 

Sex: 

unknown

Developmental Stage CV: 

Nauplius I
Target description
Fragment description

Fragment Label ID: 

F256
Phenotype

Phenotype: 

reproductive defect as adults
Upload

Image Quality: 

0
No votes yet
Subscribe to RSS - reproduction