AV F364 (F168+F169)

General

End Date: 

Wednesday, April 24, 2019 - 09:00

Experiment Description: 

Mvp1 and Mvp2/3 knock-down

Experiment Batch ID: 

AP

Start Date: 

Thursday, March 14, 2019 - 09:00

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

UN53_5145, UN52_5383
LsMvp1, LsMvp2/3

Target type: 

UN53_5145
UN52_5383

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F364

Fragment concentration: 

600.00ng/ul

Fragment length: 

576bp

Sense sequence: 

>F169 cacatggagacgaagaagtgcgattggagagagatccgtttccattatatccaggagaagagttaaaggtcaaggtcacaccattggcaatcgttcatacctcaaatgcccttttattaaaagttataagaaatttcacggacgaaaatgatgttaaacgtgtggctggagatttatttttgtttgagggacctggaacttatattccaaggaaagaggtcgaggttcttaaaaccattacagcacaagttatccatgaaaatgaagcccttaaattaagtgcaagtcgtgaaaccatagatcgatccggaattaaacacgttgcaggtgaagaatggctcataagaaagcctggagcttatttgcctttggcttatgaaaatattgtggaagttgttaaggcacatataccccttccagatgtcgcaattttggtaagagcaaaggcaactttcaaggacaagtttggtgttgagagaaaaaatggagacaaatacttgattacctttgaagatacatcagcattcattcctgaggtacaagaagaaataattggcacagtggatgctatcacac >F168 cctcccacccgaatggtcgtaatacctccaggatcttattgtgttgtatcaaaccctgttgtaacaaaagatggtactattgagaaagatcgctttggccaaattaagttatctcatggagatgaagaaattcgattaaaaagagatccttttccattatatccaggagagaaattgaaagttgaagtgacgcctttaacaatcgtacattcatcaagtgcacttcttttaaaagttatcagaaattttactgatgaagacaaaactgagcgtsttgctggagatttatacttgttcgaaggtccaggaacttattttcctagaaaagaggtggaagttgttaaaactattactgctacagtcatacatgagaatgaagctttaaaactgagtgctgctcgtgaaactttagacagatctggttgtaagagagtggcaggggagg

Fragment Mixture Formula: 

F169+F168

Fragment Producer: 

licelab

Primer Group: 

likb2502_T7_b2515
Phenotype

Phenotype CV: 

Phenotype: 

normal

Number of Individuals (End): 

15

Image file: 

Upload

Image Quality: 

0
No votes yet

Knock-down of all MVP. No visible phenotype.