AP F367 EMLSAG00000005299

General

End Date: 

Tuesday, April 10, 2018 - 09:00

Experiment Description: 

EMLSAG1458 knock-down

Experiment Batch ID: 

AP

Start Date: 

Tuesday, March 6, 2018 - 09:00

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult2

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

EMLSAG00000005299

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F367

Fragment concentration: 

600.00ng/ul

Fragment length: 

338bp

Sense sequence: 

>F367 gtatgatgacggacatgctcaagggtaacattactaacatgttgccaatgattgtaattggaggatggatcaactggcatttctcaggctttgtcactaccaaaatcccttttcccctcactcttcgtttcaagcctatgcttcaaagaggcattgaactcatgagtctagatgcttcatgggtctcctccgcctcctggtactttcttaacgttttcggactacgatctatttatgacttagttctcggagaaaataatgttgcggatcaatcaagaatcatgcaggaccagatgatgatgcctgccaacggaatggctaccgactataaacaggcc

Fragment Producer: 

licelab

Primer Group: 

likb2502_T7_b2515
Validation

Efficacy of Knock Down: 

F>16.00%
Phenotype

Phenotype CV: 

Phenotype: 

slightly shorter gonade and abdominal segment

Number of Individuals (End): 

24
AttachmentSize
Image icon 5299_b.jpg1.63 MB
Upload

Image Quality: 

0
No votes yet

Testing the fragment for Mvp1 knock-down.