shorter eggstrings

AP F367 EMLSAG00000005299

Phenotype CV: 

General

Experiment Batch ID: 

AP

Experiment Contact: 

Start Date: 

6 March, 2018 - 09:00

End Date: 

10 April, 2018 - 09:00

Experiment Description: 

EMLSAG1458 knock-down
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

EMLSAG00000005299
Fragment description

Fragment length: 

338bp

Fragment concentration: 

600ng/ul

Sense sequence: 

>F367 gtatgatgacggacatgctcaagggtaacattactaacatgttgccaatgattgtaattggaggatggatcaactggcatttctcaggctttgtcactaccaaaatcccttttcccctcactcttcgtttcaagcctatgcttcaaagaggcattgaactcatgagtctagatgcttcatgggtctcctccgcctcctggtactttcttaacgttttcggactacgatctatttatgacttagttctcggagaaaataatgttgcggatcaatcaagaatcatgcaggaccagatgatgatgcctgccaacggaatggctaccgactataaacaggcc

Fragment Label ID: 

F367

Primer Group: 

likb2502_T7_b2515

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>16%
Phenotype

Number of Individuals (End): 

24

Phenotype: 

slightly shorter gonade and abdominal segment
Upload

Image Quality: 

0
No votes yet

Testing the fragment for Mvp1 knock-down.

LsRXR

Phenotype CV: 

General

Experiment Batch ID: 

LsRXR

Experiment Contact: 

Start Date: 

13 March, 2015 - 11:54

End Date: 

7 April, 2015 - 10:02
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

50

Developmental Stage CV: 

Adult
Copepodid
Target description

Primary target ID: 

Gene or target symbol: 

LsRXR

Target type: 

protein_coding_primary_transcript
Fragment description

Fragment length: 

301bp

Fragment Label ID: 

RNAiFr1

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>60%
Phenotype

Number of Individuals (End): 

38
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

Background

Z F214

Phenotype CV: 

General

Experiment Batch ID: 

Z

Experiment Contact: 

Start Date: 

27 August, 2015 - 13:44

End Date: 

1 October, 2015 - 00:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Adult
Target description
Fragment description

Fragment length: 

766bp

Fragment concentration: 

600ng/ul

Sense sequence: 

agtgggatttgcttgcaggagtgtataaatttagggtttccacctttttaaaaagtcttgtatttgaatccaaagaaaaaagagtgaccattgatcgttctctaataaaagactatggaatcagatcaatcaataagcgaaaatattatttcttctgccttgggagtaggagcccctttggtaagggggaaattatccttaatagttttgattttgatttggatgaatttaacaattatgctctatcactccatgctaacaaaagtttaagcttaaaacgatcagtttctcgaaaaaatggaagaattaagtcaagaacaagttcagaatctgatgttaccaaacaagtttccaatttatccaaactgttttcaaaattgtttaagagcaaaaaagataggaagaaaaaattgttgaaggatagggattcgttgacatctaaagaggattactcagttgttgatgaatattcggaaatcttaccaagtggctatagtggtcaaacttatctctgcacttctgaagatttatcggatagtgaatctatgggkcttgtattkccttctccygattttwagacaaaatcctgcaaatcctttaaaaaaaataatcctaaaaaccatctcaaatggcatgaacagaatgaaatttactccgagtacgctccaagttatttgattcctgttgagcatgaaacaaaacatgaagttcttgtaaaagaaacaggagatgtctacaccctaccaatgacaaagaaaaagccaag

Fragment Label ID: 

F214

Primer Group: 

b3309

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

19

Phenotype: 

Many bad and short eggstrings. Check hatching numbers
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Unknown function of gene.

Downregulation not verified by qPCR.

Z F220

Phenotype CV: 

General

Experiment Batch ID: 

Z

Experiment Contact: 

Start Date: 

27 August, 2015 - 13:44

End Date: 

1 October, 2015 - 10:33
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Target description
Fragment description

Fragment length: 

457bp

Fragment concentration: 

600ng/ul

Sense sequence: 

aacggccttggatccagcaatatttgcaaacatcagcatgttggctcgagcagtaaaaggctctgttaagaacgacgttgctcctatgttagactccatgtttagtgttggacttagtccatctcttactatggcacttcatgagttagcgaggcatattccgtctctcaagaaagaaattgctgatggacttctcaaaatattatcacttatattaatgcaacaaccgtttagacacccaggaactcctattgcttccgcagctaattctcctactcctcctatgactctcgaaccaattccatccactgcatctgttgttcttggactacgcactctcggaacttttgattttgaaggtcactcattacttcaatttgtcagacattgtgctgatacatacctctataaagttgagaaagtggtccgacttgaagccgtcaagacatgctcctct

Fragment Label ID: 

F220

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>50%
Phenotype

Number of Individuals (End): 

17
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Repeat injections of TOR. Take out samples at 10 and 20 days after injections + at end. Look at the varations.

15 days post injections: 70% downregulation

25 days post injections: 50 % downregulation

35 days post injections 20% downregulation

B F2+F3 (IRP1+IRP2)

Phenotype CV: 

General

Experiment Batch ID: 

B

Experiment Contact: 

Start Date: 

19 March, 2012 - 09:00

End Date: 

18 April, 2012 - 09:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description
Fragment description

Fragment length: 

441bp

Fragment concentration: 

600ng/ul

Sense sequence: 

ggtgtgagtccgagtccacagcgattccaattaaattaatgaaagaagggccctcatcagggactatggaagatgaagaccttctcaaggatttccaagttggggaaagaagctacaaatattacgacgtaacccaaatccagggctatgaggaactcccttactccttgcgtgttctcctggagtgtgccgttcgaaagcgttcggaaacgcaaggacaagtctggaaggatgtttatgaacggattttgaggcgagttcttcttcaggatttcacaggagttccagcattgatcgatttagcagcgatccgtgaatctgtatccaagtccggtggttgtccggatgtggtggacagtctttgtccagcagatctggttgtagatcactgtgttcaagtggactacaaccaaatcaagcagcaactgtcaagtccgcctg

Fragment Label ID: 

F3
F2

Fragment Mixture Formula: 

1:1 mixture, resulting in 300 ng/ul for each of the fragments

Primer Group: 

b640

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>44%
Phenotype

Number of Individuals (End): 

23
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of LsIRP1A+LsIRP1B (formerly called IRP1 and IRP2) in preadult female lice. Slightly shorter egg strings. Knockdown 62% for IRP1 and 44% for IRP2. Described in the fragment fields is only F3, see experiment A for F2.

A F3 (IRP2)

Phenotype CV: 

General

Experiment Batch ID: 

A

Experiment Contact: 

Start Date: 

23 January, 2012 - 09:00

End Date: 

24 February, 2012 - 09:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

LsIRP1B
Fragment description

Fragment length: 

441bp

Fragment concentration: 

600ng/ul

Sense sequence: 

ggtgtgagtccgagtccacagcgattccaattaaattaatgaaagaagggccctcatcagggactatggaagatgaagaccttctcaaggatttccaagttggggaaagaagctacaaatattacgacgtaacccaaatccagggctatgaggaactcccttactccttgcgtgttctcctggagtgtgccgttcgaaagcgttcggaaacgcaaggacaagtctggaaggatgtttatgaacggattttgaggcgagttcttcttcaggatttcacaggagttccagcattgatcgatttagcagcgatccgtgaatctgtatccaagtccggtggttgtccggatgtggtggacagtctttgtccagcagatctggttgtagatcactgtgttcaagtggactacaaccaaatcaagcagcaactgtcaagtccgcctg

Fragment Label ID: 

F3

Primer Group: 

b640

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>45%
Phenotype

Number of Individuals (End): 

23
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of LsIRP1B (formerly called IRP2) in preadult female lice. Slightly shorter egg strings caused less offspring.

D F32/F33

Phenotype CV: 

General

Experiment Batch ID: 

d

Experiment Contact: 

Start Date: 

24 August, 2012 - 13:49

End Date: 

3 October, 2012 - 00:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

40

Developmental Stage CV: 

PreAdult2
Target description
Fragment description

Fragment concentration: 

600ng/ul

Fragment Label ID: 

F

Primer Group: 

LS_TSC2-F_b872

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>30%
Phenotype

Number of Individuals (End): 

14
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

TSC1+2, short eggstrings (15853), not the best appetite jlkj jkljlkj jk kl lj l jklkj

D F33

Phenotype CV: 

General

Experiment Batch ID: 

d

Experiment Contact: 

Start Date: 

24 August, 2012 - 13:49

End Date: 

3 October, 2012 - 00:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

40

Developmental Stage CV: 

PreAdult2
Target description

Primary target ID: 

Gene or target symbol: 

g18363_TSC2
Fragment description

Fragment length: 

432bp

Fragment concentration: 

600ng/ul

Sense sequence: 

aaaatgggcattcagcgacttggttgattggcacaatgcttataactgtttctacgagctgttgtacccatattgcaatgagaaatggtgtatgtgatagatgttatttttattgcattcgagatggaactttaagtaaggatgatattactaaaaattcggatagaagaagacacatgtcggatttttactccggtacaaataagagtcagttatcaaacttaagaagtgataaggaacttcataggcacacttctctggagagaatggagtcttctggagatgattatagagtaaaaaaagtgctacctgaaacatgcagttgttggtgctctggctgggctgaaatttacattcggcgtccaagtggggatgtatcctggatgtgtagagtgcaaaatactcagttgcttagtgcgcatacaccctcaa

Fragment Label ID: 

F33

Primer Group: 

LS_TSC2-F_b872

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>72%
Phenotype

Number of Individuals (End): 

11
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Tsc2, a bit short eggstring TSC-2: Significant downregulation (but only with primers outside the dsRNA fragments, both tested)

D F31

Phenotype CV: 

General

Experiment Batch ID: 

d

Experiment Contact: 

Start Date: 

24 August, 2012 - 13:31

End Date: 

3 October, 2012 - 00:00
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

40

Developmental Stage CV: 

PreAdult2
Target description
Fragment description

Fragment length: 

505bp

Fragment concentration: 

600ng/ul

Sense sequence: 

tgtctggggactcagcctccaagatgggaggtatcctggccatagttgctctactcaacgcggatgtttgtaacacggggagtcgaattcatcgatttggaaattatcttcaaaacaattgtttaccgggagggaactccgtgacggatcctgtggtgattgccctggctactaaagccattggccgacttactcaagtatatggtagctacaaggctaatttacgctccgacttcattaattcactcgtcaagaaatcatttgagtggctttccaaccccaatgatcgcaatgatctcaagtggtacgctgctgttctcattctaagagaaatagccatttgtgagcccactttctttttccagaacgtaccaacgttttttgatcttatcttcattcctgtcagagactcaaaaccatttcttagagaatcagccgttaatgcgctacgagctggtctcatcgttactgcccaaagagaaaccaccaaacaatccagacgcca

Fragment Label ID: 

F31

Primer Group: 

LsTOR_f_b807
Validation

Efficacy of Knock Down: 

F>0%
Phenotype

Number of Individuals (End): 

14
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

TOR, short eggstrings (14763), stunted growth of genital segment (90% of control), 2 ødipus eggstrings TOR: Significant downregulation (but only with primers outside the dsRNA fragments, both tested) NB! No downregulation BUT upregulation -95%

Subscribe to RSS - shorter eggstrings