AV F404

General

End Date: 

Wednesday, April 24, 2019 - 08:23

Experiment Description: 

injection into pradult females

Experiment Batch ID: 

AV

Start Date: 

Thursday, March 14, 2019 - 08:35

Experiment Contact: 

Sample

Developmental Stage CV: 

PreAdult1
Adult

Number of Individuals (Start): 

30

Sex: 

female

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Antisense sequence: 

TGATCCTTGGAAGAAAAGAGGATG TTCATCATTTCCAGCATTGAGTTT

Fragment Label ID: 

F404

Fragment concentration: 

600.00ng/ul

Fragment length: 

400bp

Sense sequence: 

TGTTGGCCCTATGAGTCCATCT TTTTTGTGACTTTGATGCCTTGA

Fragment Mixture Formula: 

50% of both, in total 600 ng/ul

Fragment Producer: 

licelab
Validation

Efficacy of Knock Down: 

F>50.00%
Phenotype

Phenotype CV: 

Number of Individuals (End): 

15

Gallery Image: 

Image file: 

AttachmentSize
Image icon av_andreas.png1.39 MB
Upload

Image Quality: 

0
No votes yet

Knockdown of FCGPO1 & FCGPO2 leads to missing/abnormal egg strings.