egg string deformation

Z F198

Phenotype CV: 

General

Experiment Batch ID: 

Z

Experiment Contact: 

Start Date: 

27 August, 2015 - 13:44

End Date: 

1 October, 2015 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Adult
Target description
Fragment description

Fragment length: 

415bp

Fragment concentration: 

569ng/ul

Sense sequence: 

cctcaggccccaaagctctggttattaaacttatttttgaataccaaggagagcgttctaatagtccaaaaataagaaagcttgtgctagaagaaggagagacgccgactctgggcttcttatgtgaatctttttctttaaaaagctcgcaaacattttattactacgatgatgacggggatcaaataactatatccaatgatcgagagcttctgacagccatcaaggaaaagaagtcctctgatacactaaggctctatacaggaacagagcttattccaggagatattccgagtaaaaggaaccatgagaaagatatttttgaagagatttgtaccaattgtcagaaccgaatcggtcgattctcttataaatgtgttatttgtagcggtgtgaagccttcggagtgcactcg

Fragment Label ID: 

F198

Primer Group: 

b3154

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

20

Phenotype: 

slightly wavy ES-check hatching
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Unknown function of gene

Slightly wavy egg strings.

Downregulation not verified by qPCR.

Z F204

Phenotype CV: 

General

Experiment Batch ID: 

Z

Experiment Contact: 

Start Date: 

27 August, 2015 - 13:44

End Date: 

1 October, 2015 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Adult
Target description
Fragment description

Fragment length: 

553bp

Fragment concentration: 

324ng/ul

Sense sequence: 

actcccagctgcagctgtgatatagtttcttctcatattaataaacaaggaactagtgctatcatccctactttatcctgtagcaatgaacgctttaaaatatcggatctctctcgcagaaatactagagagtactcttcttctcctcaatgtgatcaaggactcattcttttaaaacgtcttcgaatagcagataaagagctcaaagcccatgaatggatgagtgtgtgtgggaatcataaaaaatatttgcttcaggattttcctctcaaaaaccaccaatgcggtatttgttttaacagtgatcaaatacggcttagaagagtttctacaaagtcgcaggatttgtacaaaggagaagtcgtggttggggaattcgtatgttcggagtgtgatgatttgatattagatggagaaggggatgagagtcagcataaaaaaataaccattgggcagatttgggttacattggataattcattttgtcttattaatagctctgtaccttcgctcagattattatgtagaggcttaaccaacaaagagccccttc

Fragment Label ID: 

F204

Primer Group: 

b3242

Fragment Producer: 

licelab

Fragment Producer Contact: 

Phenotype

Number of Individuals (End): 

20

Phenotype: 

Slightly wavy ES-check hatching
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Unknown function of gene.

Slightly wavy egg strings.

Downregulation not verified by qPCR.

 

P F120

Phenotype CV: 

General

Experiment Batch ID: 

P

Experiment Contact: 

Start Date: 

7 March, 2014 - 15:55

End Date: 

22 April, 2014 (All day)
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

30

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

UN28_g13803
Fragment description

Fragment length: 

510bp

Fragment concentration: 

600ng/ul

Sense sequence: 

tgctctggaagatgatgaacacgatattacttttgctccgcccaattctccgattgtaccttccaatgttgttatgagaggcactatcaacattccttctcttgatcagactttgaatgcagaagacccagaaggagcatcccccattgttagaggagtttttgattcaacttggtttccatattccaactacgagaattgtccagttacccctgacgcaaaccaaacaacgtatggaagtgtatatccacacttatcttaccggcatgatctcacgtttcgagatcttcaacttgcttcctcttttcctaataatagcaaccaatttctgaatgaaagtaatatggaaattctacacaattctcttctagaatctaaatggaaacccaaggacaaaatatttgtggacctcaacaatacacttgatgaaaaagataatatcgactataactcaactattcttgcgaacaataataataacaacagtagtgtccttgagcccatgttcca

Fragment Label ID: 

F120

Primer Group: 

UN28_g13803_f_b1875

Fragment Producer: 

licelab

Fragment Producer Contact: 

Validation

Efficacy of Knock Down: 

F>5%
Phenotype

Number of Individuals (End): 

13
Upload

Gallery Image: 

Image Quality: 

0
No votes yet

                    3 individuals had very special curly eggstrings , 3 had no eggstrings , low reproduction                                                                               

E F34

Phenotype CV: 

General

Experiment Batch ID: 

E

Experiment Contact: 

Start Date: 

15 October, 2012 - 00:04

End Date: 

26 November, 2012 (All day)

Experiment Description: 

<p>24 females recovered (62%), 7 with normal looking eggstrings, that hatch. Animals with eggstrings have blood in the gut, animals w/o eggstrings have little or no blood. Theis group of animals looked almost normal and was reproducing until 3 days before termination (last check). Seem to have been caught just when the system broke down. Reproducing animals had normally developed cops (morph and numbers)</p>
Sample

Organism: 

Sex: 

female

Number of Individuals (Start): 

39

Developmental Stage CV: 

PreAdult2
Adult
Target description

Primary target ID: 

Gene or target symbol: 

g7499_LsRaptor
Fragment description

Fragment length: 

451bp

Fragment concentration: 

600ng/ul

Sense sequence: 

tcaagattcctcctcaactgccgctactccttggagactccttgaacgaatgaaaactgtgagtgttgctcttgtggtatgcctcaatgtcggggtggatcctccggatgtgacgaaaacctccccttgtgcttgtattgaggcatggattgatccaactcttctcaatccaacaagagcacttaatctcattggatctgctcttctaagacaatatgaacgttggcaacccagggctaggtatagacaatctttggacccaactgtggacgaagtccgacgcctagctatggctctacgtaaaaacgctagggatgaaagagttctttttcattataatggtcatggggtcccgaaaccaacggcaaacggagagatttgggtttttaatcggaattacactcagtatattcccctgagtctctacgatcttcaaacatggatgggctcc

Fragment Label ID: 

F34

Primer Group: 

Raptor_f_b918

Fragment Producer: 

Heidi
Validation

Efficacy of Knock Down: 

F>50%
Phenotype

Number of Individuals (End): 

24
Upload

Image file: 

Gallery Image: 

Image Quality: 

0
No votes yet

Knockdown of 3242

Subscribe to RSS - egg string deformation