beta FTZ-F1

General

End Date: 

Wednesday, January 24, 2018 - 13:00

Experiment Description: 

Sampled larvae at middle/old nauplius 2 to measure downregulation before visible phenotype.

Experiment Batch ID: 

Experiment bFTZ-F1

Start Date: 

Wednesday, January 17, 2018 - 13:00

Experiment Contact: 

Sample

Developmental Stage CV: 

Nauplius
Copepodid

Sex: 

both

Organism: 

Target description
Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

beta FTZ-F1

Fragment Batch ID: 

beta FTZ-F1

Fragment concentration: 

10.00ng/ul

Fragment ID: 

Fragment length: 

468bp

Sense sequence: 

ttgaggacaacaacgacgactcta Ctatactcattagctatacattgttgtgtggatttcgaaaagagacgcggacgataagga Gcagggaatttgtgatttcgaaaaaaaaatagtaaaaatgtgccatggtggtttgagatg Accaaatacatttataagggcaagttacgtgaaaaaggcccttgaatgttacccacggaa Cctcttattagtattccgtattctaaccaacgtggacgtttccatcaaccccatattcaa Gagctgcctctcgcagccccgggttctaatcatagatcatcatccctgatccttataaaa Aaagagccgaatatgagcacaagtggaagcttgagtagcggtggtagtcctcccatggtt Ggaggaacactcctcccaaccatggatatgccgatcggaaactcatttgcttccttggaa Gacctgagcagtgtagtccatcca

Fragment Producer: 

licelab
Validation

Efficacy of Knock Down: 

F>50.00%
Phenotype

Phenotype CV: 

Phenotype: 

Developmental arrest

Number of Individuals (End): 

0

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Soaking of larvae with dsRNA specific for the transcript variant beta for the gene FTZ-F1. Resulted in developmental arrest.