E F42

General

End Date: 

Monday, November 26, 2012 (All day)

Experiment Batch ID: 

E

Start Date: 

Monday, October 15, 2012 - 10:19

Experiment Contact: 

Publication: 

Sample

Developmental Stage CV: 

PreAdult2
Adult

Number of Individuals (Start): 

39

Sex: 

female

Organism: 

Target description

Gene or target symbol: 

g13677_Rheb

Primary target ID: 

Fragment description

Fragment Producer Contact: 

Fragment Label ID: 

F42

Fragment concentration: 

600.00ng/ul

Fragment length: 

460bp

Sense sequence: 

atggggcctcccaagtctcgtaaaattgccttaatgggagctgtttccgtgggcaaatcttctctggccatccaatttgtacaaggacaatttgtcgattcctacgaaccaacaatcgaaaatacatttaccaaaacagttaaaattaatagacaagaatatgaaatttgtcttgttgatacagcaggccaaaatgaatactctatctttccattggaatattctgtaggaatagatggatatgttcttgtatactccattgattcacctaaaagcttagaagtttgtcaaatcatacaggaaaaattaatagaattcacaggaaacccaaatgttcccattgtcttggttggcaataaaaatgatttgtatatggaaagatatgtttcctttgaagaaggcaaaagaagagctgaagaaatgaaagcagtgtttcttgagacctctgccaaggaaaacc

Fragment Producer: 

licelab

Primer Group: 

Rheb_f_b1063
Validation

Efficacy of Knock Down: 

F>60.00%
Phenotype

Phenotype CV: 

Phenotype: 

Low reproduction and most are missing blood in the gut

Number of Individuals (End): 

25

Gallery Image: 

Image file: 

Upload

Image Quality: 

0
No votes yet

Downregulation of Rheb